Rmu_sc0000117.1_g000022

hAT family C-terminal dimerisation region

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000117.1
Physical Location & Seq
Reverse (-)
91760 .. 92318
559 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000117.1_g000022.1.cds

Sequence Viewer

Length: 459 bp
atgacccatcctattgtagtggaagaaattgaatctgatgatgaatggataacagaaatagaggatttggttgttcccgccgatccacattggcttgaggacaatgtggaagatctaacattgaatgatgaggtggtaagaaatgtgccaattggtacatatcaaagtaccctaattgatagagagcctcctcgtgagcctactctttctcttgatgagcctattgttttatacaaagggaaatctagtgaaggagcatgttcaagtaaaagaaaggctccaaggaaatcaatgcatcttgatgacattacagatgaaggtattagaattaatccatatgatgacaccaatcctctcttcgagcaacatggtgatgatagtgatgaaggtgatagtgatggtggtgatagtttggatggtgatcttctgattgatgaggatgatgatttccaacaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

152

Amino Acids

17.11

Weight (kDa)

4.05

Isoelectric Point (pI)

52.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 78
AclWI GGATC 1 cut(s) 77
AfaI GTAC 2 cut(s) 157, 169
AgsI TTSAA 3 cut(s) 32, 124, 264
AjuI GAANNNNNNNTTGG 2 cut(s) 341, 373
AlwI GGATC 1 cut(s) 77
AseI ATTAAT 1 cut(s) 330
AsuHPI GGTGA 4 cut(s) 383, 401, 416, 431
BauI CACGAG 1 cut(s) 192
BccI CCATC 3 cut(s) 15, 392, 410
BfaI CTAG 1 cut(s) 246
BglII AGATCT 1 cut(s) 112
BmiI GGNNCC 1 cut(s) 279
BmsI GCATC 1 cut(s) 304
BpuEI CTTGAG 1 cut(s) 116
BsaBI GATNNNNATC 1 cut(s) 420
BsaJI CCNNGG 1 cut(s) 281
Bse8I GATNNNNATC 1 cut(s) 420
BseDI CCNNGG 1 cut(s) 281
BseGI GGATG 3 cut(s) 7, 421, 445
BseJI GATNNNNATC 1 cut(s) 420
BseRI GAGGAG 1 cut(s) 180
Bsp143I GATC 3 cut(s) 82, 112, 421
BspACI CCGC 1 cut(s) 78
BspLI GGNNCC 1 cut(s) 279
BspPI GGATC 1 cut(s) 77
BssECI CCNNGG 1 cut(s) 281
BssMI GATC 3 cut(s) 82, 112, 421
BssSI CACGAG 1 cut(s) 192
BssT1I CCWWGG 1 cut(s) 281
Bst2BI CACGAG 1 cut(s) 192
Bst6I CTCTTC 1 cut(s) 362
BstF5I GGATG 3 cut(s) 7, 421, 445
BstKTI GATC 3 cut(s) 85, 115, 424
BstMBI GATC 3 cut(s) 82, 112, 421
BstNSI RCATGY 1 cut(s) 261
BstX2I RGATCY 1 cut(s) 112
BstYI RGATCY 1 cut(s) 112
BtsCI GGATG 3 cut(s) 7, 421, 445
Csp6I GTAC 2 cut(s) 156, 168
CviAII CATG 2 cut(s) 258, 368
CviJI RGCY 5 cut(s) 94, 187, 199, 220, 278
CviKI_1 RGCY 5 cut(s) 94, 187, 199, 220, 278
CviQI GTAC 2 cut(s) 156, 168
DpnI GATC 3 cut(s) 84, 114, 423
DpnII GATC 3 cut(s) 82, 112, 421
Eam1104I CTCTTC 1 cut(s) 362
EarI CTCTTC 1 cut(s) 362
Eco130I CCWWGG 1 cut(s) 281
EcoT14I CCWWGG 1 cut(s) 281
EcoT22I ATGCAT 1 cut(s) 297
ErhI CCWWGG 1 cut(s) 281
FaeI CATG 2 cut(s) 261, 371
FaiI YATR 6 cut(s) 160, 232, 259, 337, 339, 369
FatI CATG 2 cut(s) 257, 367
FauI CCCGC 1 cut(s) 85
FauNDI CATATG 1 cut(s) 337
FokI GGATG 2 cut(s) 428, 452
FspBI CTAG 1 cut(s) 246
Hin1II CATG 2 cut(s) 261, 371
HinfI GANTC 1 cut(s) 32
HphI GGTGA 4 cut(s) 383, 401, 416, 431
Hpy188I TCNGA 2 cut(s) 37, 429
Hpy188III TCNNGA 3 cut(s) 194, 212, 299
HpyAV CCTTC 3 cut(s) 245, 311, 380
HpyCH4V TGCA 1 cut(s) 295
Hsp92II CATG 2 cut(s) 261, 371
Kzo9I GATC 3 cut(s) 82, 112, 421
LmnI GCTCC 2 cut(s) 254, 283
LweI GCATC 1 cut(s) 304
MaeI CTAG 1 cut(s) 246
MalI GATC 3 cut(s) 84, 114, 423
MboI GATC 3 cut(s) 82, 112, 421
MboII GAAGA 4 cut(s) 35, 122, 349, 416
MfeI CAATTG 1 cut(s) 150
MflI RGATCY 1 cut(s) 112
MluCI AATT 4 cut(s) 27, 150, 174, 327
MnlI CCTC 7 cut(s) 55, 91, 124, 198, 201, 363, 430
Mph1103I ATGCAT 1 cut(s) 297
MseI TTAA 1 cut(s) 330
MslI CAYNNNNRTG 2 cut(s) 300, 372
MunI CAATTG 1 cut(s) 150
NdeI CATATG 1 cut(s) 337
NdeII GATC 3 cut(s) 82, 112, 421
NlaIII CATG 2 cut(s) 261, 371
NlaIV GGNNCC 1 cut(s) 279
NsiI ATGCAT 1 cut(s) 297
NspI RCATGY 1 cut(s) 261
PfeI GAWTC 1 cut(s) 32
PshBI ATTAAT 1 cut(s) 330
PspN4I GGNNCC 1 cut(s) 279
PsuI RGATCY 1 cut(s) 112
RsaI GTAC 2 cut(s) 157, 169
RsaNI GTAC 2 cut(s) 156, 168
RseI CAYNNNNRTG 2 cut(s) 300, 372
SaqAI TTAA 1 cut(s) 330
Sau3AI GATC 3 cut(s) 82, 112, 421
SetI ASST 3 cut(s) 135, 322, 391
SfaNI GCATC 1 cut(s) 304
SmiMI CAYNNNNRTG 2 cut(s) 300, 372
SmlI CTYRAG 1 cut(s) 95
SmoI CTYRAG 1 cut(s) 95
Sse9I AATT 4 cut(s) 27, 150, 174, 327
SsiI CCGC 1 cut(s) 78
SspMI CTAG 1 cut(s) 246
StyI CCWWGG 1 cut(s) 281
TaqI TCGA 1 cut(s) 360
TasI AATT 4 cut(s) 27, 150, 174, 327
TfiI GAWTC 1 cut(s) 32
Tru1I TTAA 1 cut(s) 330
Tru9I TTAA 1 cut(s) 330
TspDTI ATGAA 3 cut(s) 57, 330, 399
VspI ATTAAT 1 cut(s) 330
XceI RCATGY 1 cut(s) 261
XspI CTAG 1 cut(s) 246
Zsp2I ATGCAT 1 cut(s) 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.