Rroxscaffold_2G00126330

hAT family C-terminal dimerisation region

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
61567303 .. 61567920
618 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00126330.1

Sequence Viewer

Length: 474 bp
ATGATCGATCCTATTGTTGTGGAAGAAATTGAATCCGATGATGAATGGATAACGGAGATAGAGGATCCAGTTCTTCCTGCTGATCCTAATTGGCTTGAGGATAGAATAGAAGATCTAACATTGAATGATGAGGCGGTAAGAAATGTGCCCGTTGTTTCATACCAAAGTACTCTAATGGATAGAGAGCCTATTCTTCAGCCTACTCCTTCTCTTGATGAGCCTATTGTTTTATACAAAAGGAAATCTAGTCAAACACCAAGTTCAAGTAGAAGAAAGCTTCGAAGGAAATCAATGCGTCTTGAAGACATTGCGGATGATGATATTAGAACTAATCCATATGAAGATACTAATCCTCTCTTTCAGCACCAAGATGATGATAGTGATGGTGATGATAGTGATGGTGGTGATAGTGATGGTGGGGATAGTTTGGATGGTGATCTTCTAGTTGATGAGGAAGATGATTTCCAAGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

157

Amino Acids

17.83

Weight (kDa)

4.05

Isoelectric Point (pI)

68.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 134, 311
AclWI GGATC 4 cut(s) 2, 59, 72, 77
AcuI CTGAAG 1 cut(s) 179
AfaI GTAC 1 cut(s) 169
AgsI TTSAA 4 cut(s) 32, 124, 264, 302
AluBI AGCT 1 cut(s) 277
AluI AGCT 1 cut(s) 277
AlwI GGATC 4 cut(s) 2, 59, 72, 77
AsuHPI GGTGA 3 cut(s) 398, 416, 446
AsuII TTCGAA 1 cut(s) 280
BaeGI GKGCMC 1 cut(s) 150
BamHI GGATCC 1 cut(s) 64
BbsI GAAGAC 1 cut(s) 309
BccI CCATC 4 cut(s) 377, 392, 407, 425
BfaI CTAG 2 cut(s) 246, 443
BglII AGATCT 1 cut(s) 112
BmcAI AGTACT 1 cut(s) 169
BmiI GGNNCC 1 cut(s) 66
BpiI GAAGAC 1 cut(s) 309
Bpu14I TTCGAA 1 cut(s) 280
BpuEI CTTGAG 1 cut(s) 116
Bsa29I ATCGAT 1 cut(s) 6
BsaBI GATNNNNATC 2 cut(s) 348, 435
Bse1I ACTGG 1 cut(s) 68
Bse3DI GCAATG 1 cut(s) 306
Bse8I GATNNNNATC 2 cut(s) 348, 435
BseCI ATCGAT 1 cut(s) 6
BseGI GGATG 2 cut(s) 319, 436
BseJI GATNNNNATC 2 cut(s) 348, 435
BseMI GCAATG 1 cut(s) 306
BseNI ACTGG 1 cut(s) 68
BseSI GKGCMC 1 cut(s) 150
BshVI ATCGAT 1 cut(s) 6
Bsp119I TTCGAA 1 cut(s) 280
Bsp1286I GDGCHC 1 cut(s) 150
Bsp143I GATC 6 cut(s) 3, 7, 64, 82, 112, 436
BspACI CCGC 2 cut(s) 134, 311
BspDI ATCGAT 1 cut(s) 6
BspLI GGNNCC 1 cut(s) 66
BspPI GGATC 4 cut(s) 2, 59, 72, 77
BspT104I TTCGAA 1 cut(s) 280
BsrDI GCAATG 1 cut(s) 306
BsrI ACTGG 1 cut(s) 68
BssMI GATC 6 cut(s) 3, 7, 64, 82, 112, 436
BstBI TTCGAA 1 cut(s) 280
BstF5I GGATG 2 cut(s) 319, 436
BstKTI GATC 6 cut(s) 6, 10, 67, 85, 115, 439
BstMBI GATC 6 cut(s) 3, 7, 64, 82, 112, 436
BstSLI GKGCMC 1 cut(s) 150
BstV2I GAAGAC 1 cut(s) 309
BstX2I RGATCY 2 cut(s) 64, 112
BstYI RGATCY 2 cut(s) 64, 112
Bsu15I ATCGAT 1 cut(s) 6
BsuTUI ATCGAT 1 cut(s) 6
BtsCI GGATG 2 cut(s) 319, 436
ClaI ATCGAT 1 cut(s) 6
CseI GACGC 1 cut(s) 284
Csp6I GTAC 1 cut(s) 168
CviAII CATG 1 cut(s) 471
CviJI RGCY 5 cut(s) 94, 187, 199, 220, 277
CviKI_1 RGCY 5 cut(s) 94, 187, 199, 220, 277
CviQI GTAC 1 cut(s) 168
DpnI GATC 6 cut(s) 5, 9, 66, 84, 114, 438
DpnII GATC 6 cut(s) 3, 7, 64, 82, 112, 436
Eco57I CTGAAG 1 cut(s) 179
FaeI CATG 1 cut(s) 474
FaiI YATR 5 cut(s) 160, 232, 337, 339, 472
FatI CATG 1 cut(s) 470
FauNDI CATATG 1 cut(s) 337
FokI GGATG 2 cut(s) 326, 443
FspBI CTAG 2 cut(s) 246, 443
HgaI GACGC 1 cut(s) 284
Hin1II CATG 1 cut(s) 474
HindIII AAGCTT 1 cut(s) 275
HinfI GANTC 1 cut(s) 32
HphI GGTGA 3 cut(s) 398, 416, 446
Hpy188I TCNGA 1 cut(s) 37
Hpy188III TCNNGA 2 cut(s) 212, 299
HpyAV CCTTC 2 cut(s) 216, 276
Hsp92II CATG 1 cut(s) 474
Kzo9I GATC 6 cut(s) 3, 7, 64, 82, 112, 436
LpnPI CCDG 2 cut(s) 81, 90
MaeI CTAG 2 cut(s) 246, 443
MalI GATC 6 cut(s) 5, 9, 66, 84, 114, 438
MboI GATC 6 cut(s) 3, 7, 64, 82, 112, 436
MboII GAAGA 9 cut(s) 35, 65, 122, 185, 282, 314, 353, 431, 467
MflI RGATCY 2 cut(s) 64, 112
MhlI GDGCHC 1 cut(s) 150
MluCI AATT 2 cut(s) 27, 88
MnlI CCTC 5 cut(s) 55, 91, 124, 363, 445
MslI CAYNNNNRTG 1 cut(s) 369
NdeI CATATG 1 cut(s) 337
NdeII GATC 6 cut(s) 3, 7, 64, 82, 112, 436
NlaIII CATG 1 cut(s) 474
NlaIV GGNNCC 1 cut(s) 66
NspV TTCGAA 1 cut(s) 280
PfeI GAWTC 1 cut(s) 32
PspN4I GGNNCC 1 cut(s) 66
PsuI RGATCY 2 cut(s) 64, 112
RsaI GTAC 1 cut(s) 169
RsaNI GTAC 1 cut(s) 168
RseI CAYNNNNRTG 1 cut(s) 369
Sau3AI GATC 6 cut(s) 3, 7, 64, 82, 112, 436
ScaI AGTACT 1 cut(s) 169
SduI GDGCHC 1 cut(s) 150
SetI ASST 1 cut(s) 279
SfuI TTCGAA 1 cut(s) 280
SmiMI CAYNNNNRTG 1 cut(s) 369
SmlI CTYRAG 1 cut(s) 95
SmoI CTYRAG 1 cut(s) 95
Sse9I AATT 2 cut(s) 27, 88
SsiI CCGC 2 cut(s) 134, 311
SspMI CTAG 2 cut(s) 246, 443
TaqI TCGA 2 cut(s) 6, 280
TasI AATT 2 cut(s) 27, 88
TatI WGTACW 1 cut(s) 167
TfiI GAWTC 1 cut(s) 32
TspDTI ATGAA 3 cut(s) 57, 147, 354
TspGWI ACGGA 1 cut(s) 68
XspI CTAG 2 cut(s) 246, 443
ZrmI AGTACT 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.