Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007718.1

Orthogroup ID

OG0002052

Physical Location & Seq

Genomic Coordinates Forward (+)

76 .. 1435

Gene Structure 1360 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007718.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 681 bp

atgaccaatcctattgtagtggaagaaattgaatctgatgatgaatggataacagagatagaggatccggttcttcccaccgatccacattggcttgaggacaatgtggaagatctagcattgaatgatgaagcggtaagaaatgtgccaattggtacatatcaaagtaccctaattgatagagagtctcctcctcgtgtgcattctcctcctcgtgagcctactcctccccgtgagcctactccttctcttgatgagcctattgctttatacaaaaggaaatctagtgaaggagcttgttcaagtaaaagaaaggctccaaggaaatcaatgcgtcttgatgacattgcggatgatggtattagaattaatccatatgatgagaccattaacgcaatccttattgttgacccaaatttgaagactgaaattgcaatccgatgcttgcataaatgtgcttccattgcaatgaattgcatggatgataatgggatcaatcgggcgtcaatggatgatgttgtgagagggcttcagtttgctttgcagatgcaagaaaacaacgaggattatattgatcacattgaaaggacggttcaaaatgagatttcaacaatcaaggacaatgaagggtcttgttctaaagagcaaaatagtggggcgaacgaatccgttcaaagttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

226

Amino Acids

25.39

Weight (kDa)

4.44

Isoelectric Point (pI)

57.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002052)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G36095 AT5G33406
fragaria_vesca	FvH4_2g19761 FvH4_2g31910 FvH4_3g32805 FvH4_3g33921 FvH4_3g33922 FvH4_4g11993 FvH4_5g36511 FvH4_6g16931 FvH4_6g16931
malus_domestica	MD01G1106300.v1.1 MD01G1106700.v1.1 MD08G1077600.v1.1
pyrus_communis	pycom01g13300 pycom06g05900 pycom12g14200 pycom13g27730 pycom16g16790
rosa_chinensis	RchiOBHm_Chr1g0361961 RchiOBHm_Chr1g0361981 RchiOBHm_Chr2g0141951 RchiOBHm_Chr7g0218361
rosa_multiflora	Rmu_co8147950.1_g000001 Rmu_co8356159.1_g000001 Rmu_sc0000117.1_g000022 Rmu_sc0007718.1_g000001
rosa_roxburghii	Rroxscaffold_2G00097000 Rroxscaffold_2G00126330 Rroxscaffold_4G00304630 Rroxscaffold_5G00366570 Rroxscaffold_5G00366580
rosa_rugosa	Rorug03G0268800 Rorug03G0268900 Rorug05G0477700 Rorug05G0477800 RorugPtG0003500.1
rosa_samantha	Rh1AG259100 Rh4AG027200 Rh7CG313700
rosa_wichuraiana	Rw0G004680 Rw1G026970 Rw4G019360 Rw6G028600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	134, 350
AclWI	GGATC	4 cut(s)	59, 72, 77, 500
AcsI	RAATTY	1 cut(s)	415
AcuI	CTGAAG	1 cut(s)	515
AcyI	GRCGYC	1 cut(s)	503
AfaI	GTAC	2 cut(s)	157, 169
AgsI	TTSAA	8 cut(s)	32, 124, 303, 421, 584, 596, 609, 674
AluBI	AGCT	1 cut(s)	296
AluI	AGCT	1 cut(s)	296
Alw26I	GTCTC	2 cut(s)	192, 377
AlwI	GGATC	4 cut(s)	59, 72, 77, 500
ApoI	RAATTY	1 cut(s)	415
AseI	ATTAAT	1 cut(s)	369
Asp700I	GAANNNNTTC	1 cut(s)	669
BamHI	GGATCC	1 cut(s)	64
BauI	CACGAG	2 cut(s)	195, 213
BbsI	GAAGAC	1 cut(s)	428
BccI	CCATC	1 cut(s)	350
BclI	TGATCA	1 cut(s)	574
BcoDI	GTCTC	2 cut(s)	192, 377
BfaI	CTAG	2 cut(s)	116, 285
BglII	AGATCT	1 cut(s)	112
BmiI	GGNNCC	2 cut(s)	66, 318
BmsI	GCATC	2 cut(s)	431, 537
BpiI	GAAGAC	1 cut(s)	428
BpuEI	CTTGAG	1 cut(s)	116
BsaHI	GRCGYC	1 cut(s)	503
BsaI	GGTCTC	1 cut(s)	377
BsaJI	CCNNGG	1 cut(s)	320
BsaWI	WCCGGW	1 cut(s)	67
Bse3DI	GCAATG	3 cut(s)	345, 462, 474
BseDI	CCNNGG	1 cut(s)	320
BseGI	GGATG	3 cut(s)	358, 487, 517
BseMI	GCAATG	3 cut(s)	345, 462, 474
BseRI	GAGGAG	5 cut(s)	180, 183, 198, 201, 216
BsiSI	CCGG	1 cut(s)	68
BsmAI	GTCTC	2 cut(s)	192, 377
BsmI	GAATGC	1 cut(s)	202
Bso31I	GGTCTC	1 cut(s)	377
Bsp143I	GATC	5 cut(s)	64, 82, 112, 492, 574
BspACI	CCGC	2 cut(s)	134, 350
BspLI	GGNNCC	2 cut(s)	66, 318
BspPI	GGATC	4 cut(s)	59, 72, 77, 500
BspTNI	GGTCTC	1 cut(s)	377
BsrDI	GCAATG	3 cut(s)	345, 462, 474
BssECI	CCNNGG	1 cut(s)	320
BssMI	GATC	5 cut(s)	64, 82, 112, 492, 574
BssNI	GRCGYC	1 cut(s)	503
BssSI	CACGAG	2 cut(s)	195, 213
BssT1I	CCWWGG	1 cut(s)	320
Bst2BI	CACGAG	2 cut(s)	195, 213
Bst4CI	ACNGT	1 cut(s)	592
BstACI	GRCGYC	1 cut(s)	503
BstC8I	GCNNGC	1 cut(s)	446
BstF5I	GGATG	3 cut(s)	358, 487, 517
BstKTI	GATC	5 cut(s)	67, 85, 115, 495, 577
BstMAI	GTCTC	2 cut(s)	192, 377
BstMBI	GATC	5 cut(s)	64, 82, 112, 492, 574
BstMWI	GCNNNNNNNGC	1 cut(s)	464
BstV2I	GAAGAC	1 cut(s)	428
BstX2I	RGATCY	2 cut(s)	64, 112
BstYI	RGATCY	2 cut(s)	64, 112
BtsCI	GGATG	3 cut(s)	358, 487, 517
Cac8I	GCNNGC	1 cut(s)	446
CseI	GACGC	2 cut(s)	323, 492
Csp6I	GTAC	2 cut(s)	156, 168
CviAII	CATG	1 cut(s)	478
CviJI	RGCY	7 cut(s)	94, 220, 238, 259, 296, 317, 529
CviKI_1	RGCY	7 cut(s)	94, 220, 238, 259, 296, 317, 529
CviQI	GTAC	2 cut(s)	156, 168
DpnI	GATC	5 cut(s)	66, 84, 114, 494, 576
DpnII	GATC	5 cut(s)	64, 82, 112, 492, 574
Eco130I	CCWWGG	1 cut(s)	320
Eco31I	GGTCTC	1 cut(s)	377
Eco57I	CTGAAG	1 cut(s)	515
EcoT14I	CCWWGG	1 cut(s)	320
ErhI	CCWWGG	1 cut(s)	320
FaeI	CATG	1 cut(s)	481
FaiI	YATR	7 cut(s)	160, 271, 376, 378, 450, 479, 570
FatI	CATG	1 cut(s)	477
FauNDI	CATATG	1 cut(s)	376
FbaI	TGATCA	1 cut(s)	574
FokI	GGATG	3 cut(s)	365, 494, 524
FspBI	CTAG	2 cut(s)	116, 285
HapII	CCGG	1 cut(s)	68
HgaI	GACGC	2 cut(s)	323, 492
Hin1I	GRCGYC	1 cut(s)	503
Hin1II	CATG	1 cut(s)	481
HincII	GTYRAC	1 cut(s)	409
HindII	GTYRAC	1 cut(s)	409
HinfI	GANTC	3 cut(s)	32, 185, 665
HpaII	CCGG	1 cut(s)	68
Hpy166II	GTNNAC	1 cut(s)	409
Hpy188I	TCNGA	2 cut(s)	37, 440
Hpy188III	TCNNGA	3 cut(s)	215, 251, 338
Hpy8I	GTNNAC	1 cut(s)	409
HpyAV	CCTTC	3 cut(s)	255, 284, 620
HpyCH4III	ACNGT	1 cut(s)	592
HpyCH4V	TGCA	7 cut(s)	202, 434, 448, 467, 477, 544, 550
HpyF10VI	GCNNNNNNNGC	1 cut(s)	464
Hsp92I	GRCGYC	1 cut(s)	503
Hsp92II	CATG	1 cut(s)	481
Ksp22I	TGATCA	1 cut(s)	574
Kzo9I	GATC	5 cut(s)	64, 82, 112, 492, 574
LmnI	GCTCC	2 cut(s)	293, 322
LpnPI	CCDG	1 cut(s)	81
LweI	GCATC	2 cut(s)	431, 537
MaeI	CTAG	2 cut(s)	116, 285
MalI	GATC	5 cut(s)	66, 84, 114, 494, 576
MboI	GATC	5 cut(s)	64, 82, 112, 492, 574
MboII	GAAGA	4 cut(s)	35, 65, 122, 433
MfeI	CAATTG	1 cut(s)	150
MflI	RGATCY	2 cut(s)	64, 112
MluCI	AATT	7 cut(s)	27, 150, 174, 366, 415, 429, 472
MlyI	GAGTC	1 cut(s)	194
MnlI	CCTC	9 cut(s)	55, 91, 201, 204, 219, 222, 237, 518, 556
MroXI	GAANNNNTTC	1 cut(s)	669
MseI	TTAA	2 cut(s)	369, 390
MslI	CAYNNNNRTG	2 cut(s)	453, 467
MspI	CCGG	1 cut(s)	68
MunI	CAATTG	1 cut(s)	150
Mva1269I	GAATGC	1 cut(s)	202
MwoI	GCNNNNNNNGC	1 cut(s)	464
NdeI	CATATG	1 cut(s)	376
NdeII	GATC	5 cut(s)	64, 82, 112, 492, 574
NlaIII	CATG	1 cut(s)	481
NlaIV	GGNNCC	2 cut(s)	66, 318
PctI	GAATGC	1 cut(s)	202
PdmI	GAANNNNTTC	1 cut(s)	669
PfeI	GAWTC	2 cut(s)	32, 665
PleI	GAGTC	1 cut(s)	193
PpsI	GAGTC	1 cut(s)	193
PshBI	ATTAAT	1 cut(s)	369
PspN4I	GGNNCC	2 cut(s)	66, 318
PsuI	RGATCY	2 cut(s)	64, 112
RsaI	GTAC	2 cut(s)	157, 169
RsaNI	GTAC	2 cut(s)	156, 168
RseI	CAYNNNNRTG	2 cut(s)	453, 467
SaqAI	TTAA	2 cut(s)	369, 390
Sau3AI	GATC	5 cut(s)	64, 82, 112, 492, 574
SchI	GAGTC	1 cut(s)	194
SetI	ASST	1 cut(s)	298
SfaNI	GCATC	2 cut(s)	431, 537
SmiMI	CAYNNNNRTG	2 cut(s)	453, 467
SmlI	CTYRAG	1 cut(s)	95
SmoI	CTYRAG	1 cut(s)	95
Sse9I	AATT	7 cut(s)	27, 150, 174, 366, 415, 429, 472
SsiI	CCGC	2 cut(s)	134, 350
SspMI	CTAG	2 cut(s)	116, 285
StyI	CCWWGG	1 cut(s)	320
TaaI	ACNGT	1 cut(s)	592
TasI	AATT	7 cut(s)	27, 150, 174, 366, 415, 429, 472
TfiI	GAWTC	2 cut(s)	32, 665
Tru1I	TTAA	2 cut(s)	369, 390
Tru9I	TTAA	2 cut(s)	369, 390
TspDTI	ATGAA	4 cut(s)	57, 144, 485, 639
TspGWI	ACGGA	1 cut(s)	658
VspI	ATTAAT	1 cut(s)	369
XapI	RAATTY	1 cut(s)	415
XmnI	GAANNNNTTC	1 cut(s)	669
XspI	CTAG	2 cut(s)	116, 285

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.