Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8356159.1

Orthogroup ID

OG0002052

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 847

Gene Structure 846 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8356159.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 362 bp

atgaccgatcctattgtagtggaaaaaattgaatctgataatgaatggataacaaagataaaggatccggttcttcccgccgatccacattggcttgaggacaatgaggaaaatctaacaatgaatgataaggcggtaagaaacgtgccaattggtacatatcaaattaccctaattgatagaaagcctccttctcgtgtgccttctcctcctcgtgagcctactccttctcttgatgagcctattgttttatacaaaaggaaatctagtgaaggagcaagttcaagcttacgccttaagcctcaaggtgaagacgttgctgaggctctcctgaaaacgcctcagccttttaaaacattggt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF659 Dimer_Tnp_hAT zf-BED

Protein Analysis

121

Amino Acids

13.61

Weight (kDa)

5.04

Isoelectric Point (pI)

50.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002052)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G36095 AT5G33406
fragaria_vesca	FvH4_2g19761 FvH4_2g31910 FvH4_3g32805 FvH4_3g33921 FvH4_3g33922 FvH4_4g11993 FvH4_5g36511 FvH4_6g16931 FvH4_6g16931
malus_domestica	MD01G1106300.v1.1 MD01G1106700.v1.1 MD08G1077600.v1.1
pyrus_communis	pycom01g13300 pycom06g05900 pycom12g14200 pycom13g27730 pycom16g16790
rosa_chinensis	RchiOBHm_Chr1g0361961 RchiOBHm_Chr1g0361981 RchiOBHm_Chr2g0141951 RchiOBHm_Chr7g0218361
rosa_multiflora	Rmu_co8147950.1_g000001 Rmu_co8356159.1_g000001 Rmu_sc0000117.1_g000022 Rmu_sc0007718.1_g000001
rosa_roxburghii	Rroxscaffold_2G00097000 Rroxscaffold_2G00126330 Rroxscaffold_4G00304630 Rroxscaffold_5G00366570 Rroxscaffold_5G00366580
rosa_rugosa	Rorug03G0268800 Rorug03G0268900 Rorug05G0477700 Rorug05G0477800 RorugPtG0003500.1
rosa_samantha	Rh1AG259100 Rh4AG027200 Rh7CG313700
rosa_wichuraiana	Rw0G004680 Rw1G026970 Rw4G019360 Rw6G028600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	78, 134
AclWI	GGATC	4 cut(s)	2, 59, 72, 77
AfaI	GTAC	1 cut(s)	157
AflII	CTTAAG	1 cut(s)	296
AgsI	TTSAA	2 cut(s)	32, 285
AluBI	AGCT	1 cut(s)	288
AluI	AGCT	1 cut(s)	288
AlwI	GGATC	4 cut(s)	2, 59, 72, 77
AsuHPI	GGTGA	1 cut(s)	320
BamHI	GGATCC	1 cut(s)	64
BauI	CACGAG	2 cut(s)	195, 213
BbsI	GAAGAC	1 cut(s)	318
BbvCI	CCTCAGC	2 cut(s)	321, 342
BfaI	CTAG	1 cut(s)	267
BfrI	CTTAAG	1 cut(s)	296
BmiI	GGNNCC	1 cut(s)	66
BpiI	GAAGAC	1 cut(s)	318
Bpu10I	CCTNAGC	2 cut(s)	321, 342
BpuEI	CTTGAG	2 cut(s)	116, 288
BsaWI	WCCGGW	1 cut(s)	67
BseMII	CTCAG	2 cut(s)	312, 356
BseRI	GAGGAG	2 cut(s)	198, 201
BsiSI	CCGG	1 cut(s)	68
Bsp143I	GATC	3 cut(s)	7, 64, 82
BspACI	CCGC	2 cut(s)	78, 134
BspCNI	CTCAG	2 cut(s)	313, 355
BspLI	GGNNCC	1 cut(s)	66
BspPI	GGATC	4 cut(s)	2, 59, 72, 77
BspTI	CTTAAG	1 cut(s)	296
BssMI	GATC	3 cut(s)	7, 64, 82
BssSI	CACGAG	2 cut(s)	195, 213
Bst2BI	CACGAG	2 cut(s)	195, 213
BstAFI	CTTAAG	1 cut(s)	296
BstDEI	CTNAG	2 cut(s)	321, 342
BstKTI	GATC	3 cut(s)	10, 67, 85
BstMBI	GATC	3 cut(s)	7, 64, 82
BstV2I	GAAGAC	1 cut(s)	318
BstX2I	RGATCY	1 cut(s)	64
BstYI	RGATCY	1 cut(s)	64
Csp6I	GTAC	1 cut(s)	156
CviJI	RGCY	8 cut(s)	94, 187, 220, 241, 288, 301, 326, 346
CviKI_1	RGCY	8 cut(s)	94, 187, 220, 241, 288, 301, 326, 346
CviQI	GTAC	1 cut(s)	156
DdeI	CTNAG	2 cut(s)	321, 342
DpnI	GATC	3 cut(s)	9, 66, 84
DpnII	GATC	3 cut(s)	7, 64, 82
DraI	TTTAAA	1 cut(s)	352
FaiI	YATR	2 cut(s)	160, 253
FauI	CCCGC	1 cut(s)	85
FspBI	CTAG	1 cut(s)	267
HapII	CCGG	1 cut(s)	68
HindIII	AAGCTT	1 cut(s)	286
HinfI	GANTC	1 cut(s)	32
HpaII	CCGG	1 cut(s)	68
HphI	GGTGA	1 cut(s)	320
Hpy188I	TCNGA	1 cut(s)	37
Hpy188III	TCNNGA	3 cut(s)	215, 233, 331
HpyAV	CCTTC	4 cut(s)	201, 213, 237, 266
HpyCH4IV	ACGT	2 cut(s)	144, 315
HpyF3I	CTNAG	2 cut(s)	321, 342
HpySE526I	ACGT	2 cut(s)	144, 315
Kzo9I	GATC	3 cut(s)	7, 64, 82
LmnI	GCTCC	1 cut(s)	275
LpnPI	CCDG	2 cut(s)	81, 344
MaeI	CTAG	1 cut(s)	267
MaeII	ACGT	2 cut(s)	144, 315
MalI	GATC	3 cut(s)	9, 66, 84
MboI	GATC	3 cut(s)	7, 64, 82
MboII	GAAGA	2 cut(s)	65, 323
MfeI	CAATTG	1 cut(s)	150
MflI	RGATCY	1 cut(s)	64
MluCI	AATT	4 cut(s)	27, 150, 165, 174
MnlI	CCTC	8 cut(s)	91, 100, 198, 219, 222, 312, 316, 351
MseI	TTAA	2 cut(s)	297, 351
MspCI	CTTAAG	1 cut(s)	296
MspI	CCGG	1 cut(s)	68
MunI	CAATTG	1 cut(s)	150
NdeII	GATC	3 cut(s)	7, 64, 82
NlaIV	GGNNCC	1 cut(s)	66
PfeI	GAWTC	1 cut(s)	32
PspN4I	GGNNCC	1 cut(s)	66
PsuI	RGATCY	1 cut(s)	64
RsaI	GTAC	1 cut(s)	157
RsaNI	GTAC	1 cut(s)	156
SaqAI	TTAA	2 cut(s)	297, 351
Sau3AI	GATC	3 cut(s)	7, 64, 82
SetI	ASST	4 cut(s)	147, 290, 310, 318
SmlI	CTYRAG	3 cut(s)	95, 296, 303
SmoI	CTYRAG	3 cut(s)	95, 296, 303
Sse9I	AATT	4 cut(s)	27, 150, 165, 174
SsiI	CCGC	2 cut(s)	78, 134
SspMI	CTAG	1 cut(s)	267
TaiI	ACGT	2 cut(s)	147, 318
TaqII	GACCGA	1 cut(s)	20
TasI	AATT	4 cut(s)	27, 150, 165, 174
TfiI	GAWTC	1 cut(s)	32
Tru1I	TTAA	2 cut(s)	297, 351
Tru9I	TTAA	2 cut(s)	297, 351
TspDTI	ATGAA	2 cut(s)	57, 137
Vha464I	CTTAAG	1 cut(s)	296
XspI	CTAG	1 cut(s)	267

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.