MD00G1184500.v1.1

Belongs to the ubiquitin-conjugating enzyme family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Forward (+)
43762737 .. 43763560
824 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1184500.v1.1.491

Sequence Viewer

Length: 420 bp
ATGTATATATGTTATGATTTGTTGCAATGTGGTACAAAGTTATACGCTTACATGCATATTAAGTTCCTAAATACACGTTTAACTCCAACTTTGAACATGCCAGAAGAATGCAAGAAGATTTCATTCCCCAATGGAAAGGTTGATTTGATGGACTTTGAGATTACCATTACACCTTATCGGGGATATTATATGGGTAGTGGGTTTGTCTTCACGTTTAAAGTTCCCGCAGTCTACCATCATGAGCCTCCGAAGGTCAAGTGCAAAACCAAGATCTACCATCCCAACATCGACTTAGAAGGAAACACTTGCCTTAACATTCTTCGGGAAGACTGGAAACCTGTCTTAAATATAAACACTGTTATTTACGGATTGTATCACCTATTCACGGTATCTTTGATCGCAACACAAAATATTTCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

140

Amino Acids

16.18

Weight (kDa)

8.54

Isoelectric Point (pI)

55.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UQ_con PF00179 42 - 129 1e-24 Ubiquitin-conjugating enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 231
AciI CCGC 1 cut(s) 225
AfaI GTAC 1 cut(s) 34
AfiI CCNNNNNNNGG 2 cut(s) 179, 385
AflIII ACRYGT 1 cut(s) 74
AgsI TTSAA 1 cut(s) 94
AsuHPI GGTGA 1 cut(s) 368
BbsI GAAGAC 2 cut(s) 199, 333
BccI CCATC 3 cut(s) 142, 243, 285
BglII AGATCT 1 cut(s) 270
BpiI GAAGAC 2 cut(s) 199, 333
Bsc4I CCNNNNNNNGG 2 cut(s) 179, 385
Bse1I ACTGG 1 cut(s) 335
Bse3DI GCAATG 1 cut(s) 32
BseGI GGATG 1 cut(s) 277
BseLI CCNNNNNNNGG 2 cut(s) 179, 385
BseMI GCAATG 1 cut(s) 32
BseNI ACTGG 1 cut(s) 335
BslI CCNNNNNNNGG 2 cut(s) 179, 385
BsmI GAATGC 1 cut(s) 113
Bsp143I GATC 2 cut(s) 270, 396
BspACI CCGC 1 cut(s) 225
BspHI TCATGA 1 cut(s) 238
BsrDI GCAATG 1 cut(s) 32
BsrI ACTGG 1 cut(s) 335
BssMI GATC 2 cut(s) 270, 396
Bst4CI ACNGT 2 cut(s) 358, 388
BstDEI CTNAG 1 cut(s) 292
BstF5I GGATG 1 cut(s) 277
BstKTI GATC 2 cut(s) 273, 399
BstMBI GATC 2 cut(s) 270, 396
BstNSI RCATGY 2 cut(s) 55, 100
BstV2I GAAGAC 2 cut(s) 199, 333
BstX2I RGATCY 1 cut(s) 270
BstYI RGATCY 1 cut(s) 270
BtsCI GGATG 1 cut(s) 277
BtsIMutI CAGTG 1 cut(s) 354
CciI TCATGA 1 cut(s) 238
Csp6I GTAC 1 cut(s) 33
CviAII CATG 3 cut(s) 52, 97, 239
CviJI RGCY 1 cut(s) 244
CviKI_1 RGCY 1 cut(s) 244
CviQI GTAC 1 cut(s) 33
DdeI CTNAG 1 cut(s) 292
DpnI GATC 2 cut(s) 272, 398
DpnII GATC 2 cut(s) 270, 396
DraI TTTAAA 1 cut(s) 217
EcoT22I ATGCAT 1 cut(s) 57
FaeI CATG 3 cut(s) 55, 100, 242
FatI CATG 3 cut(s) 51, 96, 238
FauI CCCGC 1 cut(s) 232
FblI GTMKAC 1 cut(s) 231
FokI GGATG 1 cut(s) 264
Hin1II CATG 3 cut(s) 55, 100, 242
HphI GGTGA 1 cut(s) 368
Hpy166II GTNNAC 1 cut(s) 232
Hpy188I TCNGA 1 cut(s) 249
Hpy188III TCNNGA 3 cut(s) 239, 323, 417
Hpy8I GTNNAC 1 cut(s) 232
HpyAV CCTTC 2 cut(s) 244, 290
HpyCH4III ACNGT 2 cut(s) 358, 388
HpyCH4IV ACGT 2 cut(s) 76, 212
HpyCH4V TGCA 4 cut(s) 25, 55, 111, 261
HpyF3I CTNAG 1 cut(s) 292
HpySE526I ACGT 2 cut(s) 76, 212
Hsp92II CATG 3 cut(s) 55, 100, 242
Kzo9I GATC 2 cut(s) 270, 396
LpnPI CCDG 3 cut(s) 114, 316, 351
MaeII ACGT 2 cut(s) 76, 212
MalI GATC 2 cut(s) 272, 398
MboI GATC 2 cut(s) 270, 396
MboII GAAGA 5 cut(s) 116, 127, 199, 311, 338
MflI RGATCY 1 cut(s) 270
MmeI TCCRAC 1 cut(s) 110
MnlI CCTC 1 cut(s) 255
Mph1103I ATGCAT 1 cut(s) 57
MseI TTAA 5 cut(s) 60, 80, 216, 312, 344
Mva1269I GAATGC 1 cut(s) 113
NdeII GATC 2 cut(s) 270, 396
NlaIII CATG 3 cut(s) 55, 100, 242
NsiI ATGCAT 1 cut(s) 57
NspI RCATGY 2 cut(s) 55, 100
PagI TCATGA 1 cut(s) 238
PctI GAATGC 1 cut(s) 113
PsuI RGATCY 1 cut(s) 270
RsaI GTAC 1 cut(s) 34
RsaNI GTAC 1 cut(s) 33
SaqAI TTAA 5 cut(s) 60, 80, 216, 312, 344
Sau3AI GATC 2 cut(s) 270, 396
SetI ASST 7 cut(s) 79, 141, 175, 215, 255, 340, 381
SsiI CCGC 1 cut(s) 225
SspI AATATT 1 cut(s) 412
TaaI ACNGT 2 cut(s) 358, 388
TaiI ACGT 2 cut(s) 79, 215
TaqI TCGA 1 cut(s) 288
Tru1I TTAA 5 cut(s) 60, 80, 216, 312, 344
Tru9I TTAA 5 cut(s) 60, 80, 216, 312, 344
TscAI CASTG 1 cut(s) 361
TspDTI ATGAA 1 cut(s) 111
TspGWI ACGGA 1 cut(s) 381
TspRI CASTG 1 cut(s) 361
XceI RCATGY 2 cut(s) 55, 100
XmiI GTMKAC 1 cut(s) 231
Zsp2I ATGCAT 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.