MD17G1186300.v1.1

Belongs to the ubiquitin-conjugating enzyme family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Forward (+)
22222841 .. 22223412
572 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1186300.v1.1.491

Sequence Viewer

Length: 279 bp
ATGGTTCATCTTATTACCCGTTTTAAATTTGTGCTTTTCTTTTTAATTACAGAAACCATGATCAGATTGTTTAAAGTGAAAGAAAAGCAAAAGGAAACAGCTGAAAACGCAAAGGAGAATGGTCTCGTAAAGAAGCAAAGTGCAGGAGAATTGCGTCTTCATAGAGATATAAGTGAGTTGAACATGCCAGAAGAATGCAAGATTTCATTCCCCAATGGAAAGGATGATTTGATGGACTTTGAGATTACCATTACACCTTATCGGGGATATTATATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

10.91

Weight (kDa)

7.85

Isoelectric Point (pI)

36.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 26
AfiI CCNNNNNNNGG 1 cut(s) 263
AgsI TTSAA 1 cut(s) 181
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
Alw26I GTCTC 1 cut(s) 128
ApoI RAATTY 1 cut(s) 26
BbsI GAAGAC 1 cut(s) 149
BccI CCATC 1 cut(s) 226
BclI TGATCA 1 cut(s) 60
BcoDI GTCTC 1 cut(s) 128
BpiI GAAGAC 1 cut(s) 149
BsaI GGTCTC 1 cut(s) 128
Bsc4I CCNNNNNNNGG 1 cut(s) 263
BseGI GGATG 1 cut(s) 229
BseLI CCNNNNNNNGG 1 cut(s) 263
BsgI GTGCAG 1 cut(s) 162
BslI CCNNNNNNNGG 1 cut(s) 263
BsmAI GTCTC 1 cut(s) 128
BsmI GAATGC 1 cut(s) 200
Bso31I GGTCTC 1 cut(s) 128
Bsp143I GATC 1 cut(s) 60
BspTNI GGTCTC 1 cut(s) 128
BssMI GATC 1 cut(s) 60
BstF5I GGATG 1 cut(s) 229
BstKTI GATC 1 cut(s) 63
BstMAI GTCTC 1 cut(s) 128
BstMBI GATC 1 cut(s) 60
BstMWI GCNNNNNNNGC 1 cut(s) 107
BstNSI RCATGY 1 cut(s) 187
BstV2I GAAGAC 1 cut(s) 149
BtsCI GGATG 1 cut(s) 229
CseI GACGC 1 cut(s) 143
CviAII CATG 2 cut(s) 58, 184
CviJI RGCY 1 cut(s) 101
CviKI_1 RGCY 1 cut(s) 101
DpnI GATC 1 cut(s) 62
DpnII GATC 1 cut(s) 60
DraI TTTAAA 2 cut(s) 25, 73
Eco31I GGTCTC 1 cut(s) 128
FaeI CATG 2 cut(s) 61, 187
FaiI YATR 6 cut(s) 59, 162, 170, 185, 273, 275
FatI CATG 2 cut(s) 57, 183
FbaI TGATCA 1 cut(s) 60
FokI GGATG 1 cut(s) 236
HgaI GACGC 1 cut(s) 143
Hin1II CATG 2 cut(s) 61, 187
Hpy188I TCNGA 1 cut(s) 65
HpyCH4V TGCA 2 cut(s) 143, 198
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
Hsp92II CATG 2 cut(s) 61, 187
Ksp22I TGATCA 1 cut(s) 60
Kzo9I GATC 1 cut(s) 60
LpnPI CCDG 2 cut(s) 129, 201
MalI GATC 1 cut(s) 62
MboI GATC 1 cut(s) 60
MboII GAAGA 2 cut(s) 149, 203
MluCI AATT 3 cut(s) 26, 45, 149
MseI TTAA 3 cut(s) 24, 44, 72
MspA1I CMGCKG 1 cut(s) 101
Mva1269I GAATGC 1 cut(s) 200
MwoI GCNNNNNNNGC 1 cut(s) 107
NdeII GATC 1 cut(s) 60
NlaIII CATG 2 cut(s) 61, 187
NspI RCATGY 1 cut(s) 187
PctI GAATGC 1 cut(s) 200
PvuII CAGCTG 1 cut(s) 101
SaqAI TTAA 3 cut(s) 24, 44, 72
Sau3AI GATC 1 cut(s) 60
SetI ASST 2 cut(s) 103, 259
SgeI CNNG 8 cut(s) 30, 70, 137, 156, 196, 200, 211, 275
Sse9I AATT 3 cut(s) 26, 45, 149
TasI AATT 3 cut(s) 26, 45, 149
Tru1I TTAA 3 cut(s) 24, 44, 72
Tru9I TTAA 3 cut(s) 24, 44, 72
TspDTI ATGAA 2 cut(s) 149, 195
XapI RAATTY 1 cut(s) 26
XceI RCATGY 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.