MD00G1214900.v1.1

Belongs to the ubiquitin-conjugating enzyme family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Reverse (-)
51493188 .. 51493704
517 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1214900.v1.1.491

Sequence Viewer

Length: 222 bp
ATGATCAGATTGTTTAAAGTGAAAGAAAAGCAAAAGGAAACAGCTGAAAACGCAAAGGAGAATGGTCTCGTAAAGAAGCAAAGTGCAGGAGAATTGCGTCTTCATAGAGATATAAGTGAGTTGAACATGCCAGAAGAATGCAAGATTTCATTCCCCAATGGAAAGGATGATTTGATGGACTTTGAGATTACCATTACACCTTATCGGGGATATTATATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.57

Weight (kDa)

6.58

Isoelectric Point (pI)

42.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 206
AgsI TTSAA 1 cut(s) 124
AluBI AGCT 1 cut(s) 44
AluI AGCT 1 cut(s) 44
Alw26I GTCTC 1 cut(s) 71
BbsI GAAGAC 1 cut(s) 92
BccI CCATC 1 cut(s) 169
BclI TGATCA 1 cut(s) 3
BcoDI GTCTC 1 cut(s) 71
BpiI GAAGAC 1 cut(s) 92
BsaI GGTCTC 1 cut(s) 71
Bsc4I CCNNNNNNNGG 1 cut(s) 206
BseGI GGATG 1 cut(s) 172
BseLI CCNNNNNNNGG 1 cut(s) 206
BsgI GTGCAG 1 cut(s) 105
BslI CCNNNNNNNGG 1 cut(s) 206
BsmAI GTCTC 1 cut(s) 71
BsmI GAATGC 1 cut(s) 143
Bso31I GGTCTC 1 cut(s) 71
Bsp143I GATC 1 cut(s) 3
BspTNI GGTCTC 1 cut(s) 71
BssMI GATC 1 cut(s) 3
BstF5I GGATG 1 cut(s) 172
BstKTI GATC 1 cut(s) 6
BstMAI GTCTC 1 cut(s) 71
BstMBI GATC 1 cut(s) 3
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstNSI RCATGY 1 cut(s) 130
BstV2I GAAGAC 1 cut(s) 92
BtsCI GGATG 1 cut(s) 172
CseI GACGC 1 cut(s) 86
CviAII CATG 1 cut(s) 127
CviJI RGCY 1 cut(s) 44
CviKI_1 RGCY 1 cut(s) 44
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
DraI TTTAAA 1 cut(s) 16
Eco31I GGTCTC 1 cut(s) 71
FaeI CATG 1 cut(s) 130
FaiI YATR 5 cut(s) 105, 113, 128, 216, 218
FatI CATG 1 cut(s) 126
FbaI TGATCA 1 cut(s) 3
FokI GGATG 1 cut(s) 179
HgaI GACGC 1 cut(s) 86
Hin1II CATG 1 cut(s) 130
Hpy188I TCNGA 1 cut(s) 8
HpyCH4V TGCA 2 cut(s) 86, 141
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
Hsp92II CATG 1 cut(s) 130
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 2 cut(s) 72, 144
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 2 cut(s) 92, 146
MluCI AATT 1 cut(s) 92
MseI TTAA 1 cut(s) 15
MspA1I CMGCKG 1 cut(s) 44
Mva1269I GAATGC 1 cut(s) 143
MwoI GCNNNNNNNGC 1 cut(s) 50
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 130
NspI RCATGY 1 cut(s) 130
PctI GAATGC 1 cut(s) 143
PvuII CAGCTG 1 cut(s) 44
SaqAI TTAA 1 cut(s) 15
Sau3AI GATC 1 cut(s) 3
SetI ASST 2 cut(s) 46, 202
SgeI CNNG 6 cut(s) 80, 99, 139, 143, 154, 218
Sse9I AATT 1 cut(s) 92
TasI AATT 1 cut(s) 92
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TspDTI ATGAA 2 cut(s) 92, 138
XceI RCATGY 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.