MD09G1074800.v1.1

Pollen proteins Ole e I like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0001665
Physical Location & Seq
Forward (+)
5211027 .. 5211986
960 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1074800.v1.1.491

Sequence Viewer

Length: 198 bp
ATGTCTTGGTTTTTTACAGTTCTCTTTCTTGTTACTGCTCTTACATTTCATACTCCTTCAGAGGCTAGCCATGAGAAGAACGATCCTTCTGCAGTTGTTGTAGGCACTGTCTACTGTGACACATGTTTCCAAGAGGATTTCTCACATACCAGCCATTTCATTTCAGAAAGCACTTGTTCAGCAATTTTTGGCTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pollen_Ole_e_I

Protein Analysis

66

Amino Acids

7.28

Weight (kDa)

4.66

Isoelectric Point (pI)

28.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 111
AclWI GGATC 1 cut(s) 77
AcuI CTGAAG 1 cut(s) 42
AflIII ACRYGT 1 cut(s) 122
AlwI GGATC 1 cut(s) 77
AsuNHI GCTAGC 1 cut(s) 65
BcgI CGANNNNNNTGC 2 cut(s) 71, 105
BfaI CTAG 1 cut(s) 66
BfmI CTRYAG 1 cut(s) 90
BmtI GCTAGC 1 cut(s) 69
BplI GAGNNNNNCTC 2 cut(s) 125, 157
Bsp143I GATC 1 cut(s) 82
BspMAI CTGCAG 1 cut(s) 94
BspOI GCTAGC 1 cut(s) 69
BspPI GGATC 1 cut(s) 77
BssMI GATC 1 cut(s) 82
Bst4CI ACNGT 3 cut(s) 19, 109, 116
BstC8I GCNNGC 1 cut(s) 67
BstKTI GATC 1 cut(s) 85
BstMBI GATC 1 cut(s) 82
BstNSI RCATGY 1 cut(s) 126
BstSFI CTRYAG 1 cut(s) 90
BtsIMutI CAGTG 1 cut(s) 105
Cac8I GCNNGC 1 cut(s) 67
CviAII CATG 2 cut(s) 71, 123
CviJI RGCY 4 cut(s) 65, 69, 153, 192
CviKI_1 RGCY 4 cut(s) 65, 69, 153, 192
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
Eco57I CTGAAG 1 cut(s) 42
FaeI CATG 2 cut(s) 74, 126
FaiI YATR 4 cut(s) 51, 72, 124, 147
FatI CATG 2 cut(s) 70, 122
FblI GTMKAC 1 cut(s) 111
FspBI CTAG 1 cut(s) 66
Hin1II CATG 2 cut(s) 74, 126
Hpy166II GTNNAC 1 cut(s) 112
Hpy188I TCNGA 2 cut(s) 61, 166
Hpy8I GTNNAC 1 cut(s) 112
HpyAV CCTTC 2 cut(s) 66, 96
HpyCH4III ACNGT 3 cut(s) 19, 109, 116
HpyCH4V TGCA 1 cut(s) 92
Hsp92II CATG 2 cut(s) 74, 126
Kzo9I GATC 1 cut(s) 82
LpnPI CCDG 1 cut(s) 163
MaeI CTAG 1 cut(s) 66
MaeIII GTNAC 2 cut(s) 31, 116
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MboII GAAGA 1 cut(s) 88
MluCI AATT 1 cut(s) 183
MnlI CCTC 2 cut(s) 55, 127
NdeII GATC 1 cut(s) 82
NheI GCTAGC 1 cut(s) 65
NlaIII CATG 2 cut(s) 74, 126
NmuCI GTSAC 1 cut(s) 116
NspI RCATGY 1 cut(s) 126
PciI ACATGT 1 cut(s) 122
PscI ACATGT 1 cut(s) 122
PstI CTGCAG 1 cut(s) 94
Sau3AI GATC 1 cut(s) 82
SfcI CTRYAG 1 cut(s) 90
SgeI CNNG 8 cut(s) 18, 41, 78, 83, 135, 143, 162, 186
Sse9I AATT 1 cut(s) 183
SspMI CTAG 1 cut(s) 66
TaaI ACNGT 3 cut(s) 19, 109, 116
TasI AATT 1 cut(s) 183
TscAI CASTG 1 cut(s) 112
TseFI GTSAC 1 cut(s) 116
Tsp45I GTSAC 1 cut(s) 116
TspDTI ATGAA 2 cut(s) 38, 148
TspRI CASTG 1 cut(s) 112
XceI RCATGY 1 cut(s) 126
XmiI GTMKAC 1 cut(s) 111
XspI CTAG 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.