pycom09g00180

Pollen proteins Ole e I like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Forward (+)
157304 .. 157552
249 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g00180.1

Sequence Viewer

Length: 249 bp
ATGGGATCTAAAACCATGTCTTGGTTTTTTACAGTTATCTTTCTTGTTACTGCTCTTACATTTCATACTCCTTCAGAGGCTAGCCATGAGAAGAACGATCCTTCTGCAGTTATTGTAGCAACTGTCTACTGTGACACATGTTTCCAAGAGGATTTCTCACATACCAGCCATTTCATTTCAGGTAAATTAATCTCAAATTTTCAACAAGTTCTTCATCAAATTTATTTTTATATTGTAGTCCGGCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.41

Weight (kDa)

6.14

Isoelectric Point (pI)

22.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 21
AccI GTMKAC 1 cut(s) 126
AclWI GGATC 2 cut(s) 13, 92
AcsI RAATTY 2 cut(s) 196, 219
AcuI CTGAAG 1 cut(s) 57
AfiI CCNNNNNNNGG 1 cut(s) 21
AflIII ACRYGT 1 cut(s) 137
AgsI TTSAA 1 cut(s) 203
AlwI GGATC 2 cut(s) 13, 92
ApoI RAATTY 2 cut(s) 196, 219
AseI ATTAAT 1 cut(s) 188
AsuNHI GCTAGC 1 cut(s) 80
BcgI CGANNNNNNTGC 2 cut(s) 86, 120
BfaI CTAG 1 cut(s) 81
BfmI CTRYAG 1 cut(s) 105
BmtI GCTAGC 1 cut(s) 84
BplI GAGNNNNNCTC 2 cut(s) 140, 172
Bsc4I CCNNNNNNNGG 1 cut(s) 21
BseLI CCNNNNNNNGG 1 cut(s) 21
BsiSI CCGG 1 cut(s) 241
BslI CCNNNNNNNGG 1 cut(s) 21
Bsp143I GATC 2 cut(s) 5, 97
BspMAI CTGCAG 1 cut(s) 109
BspOI GCTAGC 1 cut(s) 84
BspPI GGATC 2 cut(s) 13, 92
BssMI GATC 2 cut(s) 5, 97
Bst4CI ACNGT 3 cut(s) 34, 124, 131
BstC8I GCNNGC 1 cut(s) 82
BstKTI GATC 2 cut(s) 8, 100
BstMBI GATC 2 cut(s) 5, 97
BstNSI RCATGY 1 cut(s) 141
BstSFI CTRYAG 1 cut(s) 105
BstX2I RGATCY 1 cut(s) 5
BstYI RGATCY 1 cut(s) 5
Cac8I GCNNGC 1 cut(s) 82
CviAII CATG 3 cut(s) 16, 86, 138
CviJI RGCY 4 cut(s) 80, 84, 168, 244
CviKI_1 RGCY 4 cut(s) 80, 84, 168, 244
DpnI GATC 2 cut(s) 7, 99
DpnII GATC 2 cut(s) 5, 97
Eco57I CTGAAG 1 cut(s) 57
FaeI CATG 3 cut(s) 19, 89, 141
FaiI YATR 7 cut(s) 17, 66, 87, 139, 162, 231, 247
FatI CATG 3 cut(s) 15, 85, 137
FblI GTMKAC 1 cut(s) 126
FspBI CTAG 1 cut(s) 81
HapII CCGG 1 cut(s) 241
Hin1II CATG 3 cut(s) 19, 89, 141
HpaII CCGG 1 cut(s) 241
Hpy166II GTNNAC 1 cut(s) 127
Hpy188I TCNGA 1 cut(s) 76
Hpy8I GTNNAC 1 cut(s) 127
HpyAV CCTTC 2 cut(s) 81, 111
HpyCH4III ACNGT 3 cut(s) 34, 124, 131
HpyCH4V TGCA 1 cut(s) 107
Hsp92II CATG 3 cut(s) 19, 89, 141
Kzo9I GATC 2 cut(s) 5, 97
LpnPI CCDG 2 cut(s) 165, 178
MaeI CTAG 1 cut(s) 81
MaeIII GTNAC 2 cut(s) 46, 131
MalI GATC 2 cut(s) 7, 99
MboI GATC 2 cut(s) 5, 97
MboII GAAGA 2 cut(s) 103, 203
MflI RGATCY 1 cut(s) 5
MluCI AATT 3 cut(s) 185, 196, 219
MnlI CCTC 2 cut(s) 70, 142
MseI TTAA 1 cut(s) 188
MspI CCGG 1 cut(s) 241
NdeII GATC 2 cut(s) 5, 97
NheI GCTAGC 1 cut(s) 80
NlaIII CATG 3 cut(s) 19, 89, 141
NmuCI GTSAC 1 cut(s) 131
NspI RCATGY 1 cut(s) 141
PciI ACATGT 1 cut(s) 137
PflMI CCANNNNNTGG 1 cut(s) 21
PscI ACATGT 1 cut(s) 137
PshBI ATTAAT 1 cut(s) 188
PstI CTGCAG 1 cut(s) 109
PsuI RGATCY 1 cut(s) 5
SaqAI TTAA 1 cut(s) 188
Sau3AI GATC 2 cut(s) 5, 97
SetI ASST 1 cut(s) 184
SfcI CTRYAG 1 cut(s) 105
Sse9I AATT 3 cut(s) 185, 196, 219
SspMI CTAG 1 cut(s) 81
TaaI ACNGT 3 cut(s) 34, 124, 131
TasI AATT 3 cut(s) 185, 196, 219
Tru1I TTAA 1 cut(s) 188
Tru9I TTAA 1 cut(s) 188
TseFI GTSAC 1 cut(s) 131
Tsp45I GTSAC 1 cut(s) 131
TspDTI ATGAA 3 cut(s) 53, 163, 203
Van91I CCANNNNNTGG 1 cut(s) 21
VspI ATTAAT 1 cut(s) 188
XapI RAATTY 2 cut(s) 196, 219
XceI RCATGY 1 cut(s) 141
XmiI GTMKAC 1 cut(s) 126
XspI CTAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.