Rmu_co8019616.1_g000001

Pollen proteins Ole e I like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8019616.1
OG0001665
Physical Location & Seq
Forward (+)
1 .. 538
538 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8019616.1_g000001.1.cds

Sequence Viewer

Length: 538 bp
gtttatttttatacaggggcctctgttggtgtggagtgcaaagatgagagttcgtcgaaaccaagttttcaagcacaagtgaaaacagataaccaaggagtgttcaaagtccacttgcctttctcagtaagcaaacatgtgaaggaaattgaagggtgttctgtgaagctaatcagcagcagtgaaccccactgtgctgtggcctcaacagcagcctcatcttcgcttcccctcaagtccaggaagcaaggaacacacattttctcagctgggttttttgccttcaagcccctaaagcaaggcaacctatgtaaccaaaaatcaagctccaacaagctgccattttcctcaccaattcaacaacaagacatattgggaattggacttccaggtcttccaggactaccaggtttgccgggacttccaggtctacctggacttccgggtcttccaggactcccaggacttccaggaatcggagctcagccagagcaaataccagagtccaaatctgaaaccaaaactactacttctaagg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pollen_Ole_e_I

Protein Analysis

179

Amino Acids

18.63

Weight (kDa)

9.21

Isoelectric Point (pI)

56.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 3 cut(s) 390, 426, 444
AccI GTMKAC 1 cut(s) 430
AfiI CCNNNNNNNGG 1 cut(s) 476
AflIII ACRYGT 1 cut(s) 136
AgsI TTSAA 5 cut(s) 71, 106, 152, 286, 359
AjnI CCWGG 9 cut(s) 239, 388, 397, 406, 424, 433, 451, 460, 469
AluBI AGCT 5 cut(s) 169, 269, 327, 337, 482
AluI AGCT 5 cut(s) 169, 269, 327, 337, 482
Alw21I GWGCWC 1 cut(s) 484
AoxI GGCC 2 cut(s) 18, 201
ApeKI GCWGC 3 cut(s) 177, 212, 337
AspS9I GGNCC 1 cut(s) 18
AsuC2I CCSGG 2 cut(s) 417, 444
AsuHPI GGTGA 1 cut(s) 342
BanII GRGCYC 1 cut(s) 484
BbsI GAAGAC 2 cut(s) 386, 440
Bbv12I GWGCWC 1 cut(s) 484
BbvI GCAGC 3 cut(s) 189, 224, 324
BciT130I CCWGG 9 cut(s) 241, 390, 399, 408, 426, 435, 453, 462, 471
BcnI CCSGG 2 cut(s) 417, 444
BisI GCNGC 3 cut(s) 178, 213, 338
BlpI GCTNAGC 1 cut(s) 483
BlsI GCNGC 3 cut(s) 179, 214, 339
BmgT120I GGNCC 1 cut(s) 18
BmiI GGNNCC 1 cut(s) 19
BpiI GAAGAC 2 cut(s) 386, 440
Bpu1102I GCTNAGC 1 cut(s) 483
BpuEI CTTGAG 1 cut(s) 218
BpuMI CCSGG 2 cut(s) 417, 444
BsaJI CCNNGG 2 cut(s) 94, 460
Bsc4I CCNNNNNNNGG 1 cut(s) 476
BseBI CCWGG 9 cut(s) 241, 390, 399, 408, 426, 435, 453, 462, 471
BseDI CCNNGG 2 cut(s) 94, 460
BseLI CCNNNNNNNGG 1 cut(s) 476
BseMII CTCAG 3 cut(s) 138, 279, 497
BseXI GCAGC 3 cut(s) 189, 224, 324
BseYI CCCAGC 1 cut(s) 269
BshFI GGCC 2 cut(s) 20, 203
BsiHKAI GWGCWC 1 cut(s) 484
BsiSI CCGG 2 cut(s) 416, 443
BslFI GGGAC 1 cut(s) 432
BslI CCNNNNNNNGG 1 cut(s) 476
BsmFI GGGAC 1 cut(s) 432
BsnI GGCC 2 cut(s) 20, 203
Bsp1286I GDGCHC 1 cut(s) 484
Bsp1720I GCTNAGC 1 cut(s) 483
BspANI GGCC 2 cut(s) 20, 203
BspCNI CTCAG 3 cut(s) 137, 278, 496
BspLI GGNNCC 1 cut(s) 19
BssECI CCNNGG 2 cut(s) 94, 460
BssT1I CCWWGG 1 cut(s) 94
Bst2UI CCWGG 9 cut(s) 241, 390, 399, 408, 426, 435, 453, 462, 471
Bst4CI ACNGT 1 cut(s) 194
BstDEI CTNAG 4 cut(s) 124, 265, 483, 534
BstMWI GCNNNNNNNGC 2 cut(s) 209, 295
BstNI CCWGG 9 cut(s) 241, 390, 399, 408, 426, 435, 453, 462, 471
BstNSI RCATGY 1 cut(s) 140
BstV1I GCAGC 3 cut(s) 189, 224, 324
BstV2I GAAGAC 2 cut(s) 386, 440
BsuRI GGCC 2 cut(s) 20, 203
BtsI GCAGTG 1 cut(s) 187
BtsIMutI CAGTG 2 cut(s) 187, 190
Cfr13I GGNCC 1 cut(s) 18
CsiI ACCWGGT 1 cut(s) 406
CviAII CATG 1 cut(s) 137
DdeI CTNAG 4 cut(s) 124, 265, 483, 534
DrdI GACNNNNNNGTC 3 cut(s) 390, 426, 444
DseDI GACNNNNNNGTC 3 cut(s) 390, 426, 444
Ecl136II GAGCTC 1 cut(s) 482
Eco130I CCWWGG 1 cut(s) 94
Eco24I GRGCYC 1 cut(s) 484
Eco53kI GAGCTC 1 cut(s) 482
EcoICRI GAGCTC 1 cut(s) 482
EcoO109I RGGNCCY 1 cut(s) 18
EcoRII CCWGG 9 cut(s) 239, 388, 397, 406, 424, 433, 451, 460, 469
EcoT14I CCWWGG 1 cut(s) 94
EcoT38I GRGCYC 1 cut(s) 484
ErhI CCWWGG 1 cut(s) 94
FaeI CATG 1 cut(s) 140
FaiI YATR 4 cut(s) 12, 138, 310, 371
FaqI GGGAC 1 cut(s) 432
FatI CATG 1 cut(s) 136
FblI GTMKAC 1 cut(s) 430
Fnu4HI GCNGC 3 cut(s) 178, 213, 338
FriOI GRGCYC 1 cut(s) 484
Fsp4HI GCNGC 3 cut(s) 178, 213, 338
GluI GCNGC 3 cut(s) 178, 213, 338
GsaI CCCAGC 1 cut(s) 273
HaeIII GGCC 2 cut(s) 20, 203
HapII CCGG 2 cut(s) 416, 443
Hin1II CATG 1 cut(s) 140
HinfI GANTC 3 cut(s) 456, 474, 503
HpaII CCGG 2 cut(s) 416, 443
HphI GGTGA 1 cut(s) 342
Hpy166II GTNNAC 3 cut(s) 112, 185, 431
Hpy188I TCNGA 2 cut(s) 479, 514
Hpy8I GTNNAC 3 cut(s) 112, 185, 431
Hpy99I CGWCG 1 cut(s) 58
HpyAV CCTTC 3 cut(s) 136, 146, 292
HpyCH4III ACNGT 1 cut(s) 194
HpyCH4V TGCA 1 cut(s) 39
HpyF10VI GCNNNNNNNGC 2 cut(s) 209, 295
HpyF3I CTNAG 4 cut(s) 124, 265, 483, 534
Hsp92II CATG 1 cut(s) 140
LmnI GCTCC 2 cut(s) 332, 479
Lsp1109I GCAGC 3 cut(s) 189, 224, 324
MabI ACCWGGT 1 cut(s) 406
MaeIII GTNAC 1 cut(s) 311
MboII GAAGA 3 cut(s) 213, 386, 440
MhlI GDGCHC 1 cut(s) 484
MluCI AATT 3 cut(s) 147, 354, 378
MlyI GAGTC 2 cut(s) 450, 512
MmeI TCCRAC 1 cut(s) 354
MnlI CCTC 5 cut(s) 31, 214, 226, 242, 358
MspA1I CMGCKG 1 cut(s) 269
MspI CCGG 2 cut(s) 416, 443
MvaI CCWGG 9 cut(s) 241, 390, 399, 408, 426, 435, 453, 462, 471
MwoI GCNNNNNNNGC 2 cut(s) 209, 295
NciI CCSGG 2 cut(s) 417, 444
NlaIII CATG 1 cut(s) 140
NlaIV GGNNCC 1 cut(s) 19
NspI RCATGY 1 cut(s) 140
PciI ACATGT 1 cut(s) 136
PfeI GAWTC 1 cut(s) 474
PfoI TCCNGGA 4 cut(s) 239, 397, 451, 469
PkrI GCNGC 3 cut(s) 179, 214, 339
PleI GAGTC 2 cut(s) 450, 511
PpsI GAGTC 2 cut(s) 450, 511
PscI ACATGT 1 cut(s) 136
Psp124BI GAGCTC 1 cut(s) 484
Psp6I CCWGG 9 cut(s) 239, 388, 397, 406, 424, 433, 451, 460, 469
PspFI CCCAGC 1 cut(s) 269
PspGI CCWGG 9 cut(s) 239, 388, 397, 406, 424, 433, 451, 460, 469
PspN4I GGNNCC 1 cut(s) 19
PspPI GGNCC 1 cut(s) 18
PvuII CAGCTG 1 cut(s) 269
SacI GAGCTC 1 cut(s) 484
SatI GCNGC 3 cut(s) 178, 213, 338
Sau96I GGNCC 1 cut(s) 18
SchI GAGTC 2 cut(s) 450, 512
SduI GDGCHC 1 cut(s) 484
SexAI ACCWGGT 1 cut(s) 406
SmlI CTYRAG 1 cut(s) 233
SmoI CTYRAG 1 cut(s) 233
Sse9I AATT 3 cut(s) 147, 354, 378
SstI GAGCTC 1 cut(s) 484
StyI CCWWGG 1 cut(s) 94
TaaI ACNGT 1 cut(s) 194
TaqI TCGA 1 cut(s) 56
TasI AATT 3 cut(s) 147, 354, 378
TfiI GAWTC 1 cut(s) 474
TscAI CASTG 2 cut(s) 187, 197
TseI GCWGC 3 cut(s) 177, 212, 337
TspRI CASTG 2 cut(s) 187, 197
XceI RCATGY 1 cut(s) 140
XmiI GTMKAC 1 cut(s) 430
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.