Rmu_sc0022409.1_g000001

Pollen proteins Ole e I like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0022409.1
OG0001665
Physical Location & Seq
Reverse (-)
2 .. 357
356 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0022409.1_g000001.1.cds

Sequence Viewer

Length: 227 bp
atgtcttggtttctaaccatattccttctcattagtctagcatttatcactccttcagagggtaaccatgaggagaaggttcaatctgccgttgttataggcaaagtatactgtgatacatgcttccaagacgggttcgcgaaaactagccacttcatttctggggcctctgttggtgtggagtgcaaagatgagagttcgtcgaaaccaagttttcaagcacaagt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pollen_Ole_e_I

Protein Analysis

76

Amino Acids

8.28

Weight (kDa)

5.08

Isoelectric Point (pI)

38.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 108
AccII CGCG 1 cut(s) 140
AcuI CTGAAG 1 cut(s) 39
AfiI CCNNNNNNNGG 1 cut(s) 59
AgsI TTSAA 2 cut(s) 83, 218
AoxI GGCC 1 cut(s) 165
AspS9I GGNCC 1 cut(s) 165
BceAI ACGGC 1 cut(s) 74
BfaI CTAG 2 cut(s) 38, 147
BmgT120I GGNCC 1 cut(s) 165
BmiI GGNNCC 1 cut(s) 166
Bsc4I CCNNNNNNNGG 1 cut(s) 59
BseLI CCNNNNNNNGG 1 cut(s) 59
BseRI GAGGAG 1 cut(s) 86
Bsh1236I CGCG 1 cut(s) 140
BshFI GGCC 1 cut(s) 167
BslI CCNNNNNNNGG 1 cut(s) 59
BsnI GGCC 1 cut(s) 167
Bsp68I TCGCGA 1 cut(s) 140
BspANI GGCC 1 cut(s) 167
BspFNI CGCG 1 cut(s) 140
BspLI GGNNCC 1 cut(s) 166
BssNAI GTATAC 1 cut(s) 109
Bst1107I GTATAC 1 cut(s) 109
Bst4CI ACNGT 1 cut(s) 113
BstEII GGTNACC 1 cut(s) 62
BstFNI CGCG 1 cut(s) 140
BstNSI RCATGY 1 cut(s) 123
BstPI GGTNACC 1 cut(s) 62
BstUI CGCG 1 cut(s) 140
BstZ17I GTATAC 1 cut(s) 109
BsuRI GGCC 1 cut(s) 167
BtuMI TCGCGA 1 cut(s) 140
Cfr13I GGNCC 1 cut(s) 165
CviAII CATG 2 cut(s) 68, 120
CviJI RGCY 2 cut(s) 150, 167
CviKI_1 RGCY 2 cut(s) 150, 167
Eco57I CTGAAG 1 cut(s) 39
Eco91I GGTNACC 1 cut(s) 62
EcoO109I RGGNCCY 1 cut(s) 165
EcoO65I GGTNACC 1 cut(s) 62
FaeI CATG 2 cut(s) 71, 123
FaiI YATR 5 cut(s) 20, 69, 98, 109, 121
FatI CATG 2 cut(s) 67, 119
FblI GTMKAC 1 cut(s) 108
FspBI CTAG 2 cut(s) 38, 147
HaeIII GGCC 1 cut(s) 167
Hin1II CATG 2 cut(s) 71, 123
Hpy166II GTNNAC 1 cut(s) 109
Hpy188I TCNGA 1 cut(s) 58
Hpy188III TCNNGA 1 cut(s) 139
Hpy8I GTNNAC 1 cut(s) 109
Hpy99I CGWCG 1 cut(s) 205
HpyAV CCTTC 3 cut(s) 35, 63, 70
HpyCH4III ACNGT 1 cut(s) 113
HpyCH4V TGCA 1 cut(s) 186
Hsp92II CATG 2 cut(s) 71, 123
LpnPI CCDG 1 cut(s) 147
MaeI CTAG 2 cut(s) 38, 147
MaeIII GTNAC 1 cut(s) 62
MnlI CCTC 3 cut(s) 52, 64, 178
MvnI CGCG 1 cut(s) 140
NlaIII CATG 2 cut(s) 71, 123
NlaIV GGNNCC 1 cut(s) 166
NruI TCGCGA 1 cut(s) 140
NspI RCATGY 1 cut(s) 123
PspEI GGTNACC 1 cut(s) 62
PspN4I GGNNCC 1 cut(s) 166
PspPI GGNCC 1 cut(s) 165
RruI TCGCGA 1 cut(s) 140
Sau96I GGNCC 1 cut(s) 165
SetI ASST 1 cut(s) 81
SspMI CTAG 2 cut(s) 38, 147
TaaI ACNGT 1 cut(s) 113
TaqI TCGA 1 cut(s) 203
TspDTI ATGAA 1 cut(s) 145
XceI RCATGY 1 cut(s) 123
XcmI CCANNNNNNNNNTGG 1 cut(s) 158
XmiI GTMKAC 1 cut(s) 108
XspI CTAG 2 cut(s) 38, 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.