MD11G1214900.v1.1

zinc finger CCCH domain-containing protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Forward (+)
31386323 .. 31388763
2441 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1214900.v1.1.491

Sequence Viewer

Length: 228 bp
ATGAACGAGATAAATACAACCGAGGAAGCAATTCCAACTAGGTACTACTGCTACAGGTGTCGTCATCTGGTCACTGTGGATGTCGAAGTCGAAATCAAATGCCCTTTCTGCCAAGACGGCTTCATCCAACCATGCGAGGGTGTTAACTCACGCTACCTAACCATGTCATCCGAATCTGAGCTTTCTGAAAGTGGTTCAGATGGAGAGGTGCGCACCATTTTAATTTAA

Protein Analysis

76

Amino Acids

8.56

Weight (kDa)

4.44

Isoelectric Point (pI)

49.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Zn_ribbon_19 PF14369 13 - 42 5.6e-08 zinc-ribbon
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 212
AfaI GTAC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 137
AluBI AGCT 1 cut(s) 181
AluI AGCT 1 cut(s) 181
Asp700I GAANNNNTTC 1 cut(s) 30
AspLEI GCGC 1 cut(s) 213
BccI CCATC 1 cut(s) 194
BceAI ACGGC 1 cut(s) 133
BfaI CTAG 1 cut(s) 39
BfmI CTRYAG 1 cut(s) 52
BglI GCCNNNNNGGC 1 cut(s) 117
BsaJI CCNNGG 1 cut(s) 21
Bsc4I CCNNNNNNNGG 1 cut(s) 137
BseDI CCNNGG 1 cut(s) 21
BseGI GGATG 3 cut(s) 85, 123, 167
BseLI CCNNNNNNNGG 1 cut(s) 137
BseMII CTCAG 1 cut(s) 168
BslI CCNNNNNNNGG 1 cut(s) 137
BspCNI CTCAG 1 cut(s) 169
BssECI CCNNGG 1 cut(s) 21
Bst4CI ACNGT 1 cut(s) 76
BstDEI CTNAG 1 cut(s) 177
BstF5I GGATG 3 cut(s) 85, 123, 167
BstHHI GCGC 1 cut(s) 213
BstMWI GCNNNNNNNGC 2 cut(s) 108, 117
BstSFI CTRYAG 1 cut(s) 52
BtsCI GGATG 3 cut(s) 85, 123, 167
BtsIMutI CAGTG 1 cut(s) 72
CfoI GCGC 1 cut(s) 213
Csp6I GTAC 1 cut(s) 43
CviAII CATG 2 cut(s) 132, 163
CviJI RGCY 2 cut(s) 120, 181
CviKI_1 RGCY 2 cut(s) 120, 181
CviQI GTAC 1 cut(s) 43
DdeI CTNAG 1 cut(s) 177
FaeI CATG 2 cut(s) 135, 166
FaiI YATR 2 cut(s) 133, 164
FatI CATG 2 cut(s) 131, 162
FokI GGATG 3 cut(s) 92, 110, 154
FspAI RTGCGCAY 1 cut(s) 212
FspBI CTAG 1 cut(s) 39
FspI TGCGCA 1 cut(s) 212
GlaI GCGC 1 cut(s) 212
HhaI GCGC 1 cut(s) 213
Hin1II CATG 2 cut(s) 135, 166
Hin6I GCGC 1 cut(s) 211
HinP1I GCGC 1 cut(s) 211
HincII GTYRAC 1 cut(s) 145
HindII GTYRAC 1 cut(s) 145
HinfI GANTC 1 cut(s) 173
HpaI GTTAAC 1 cut(s) 145
Hpy166II GTNNAC 1 cut(s) 145
Hpy188I TCNGA 4 cut(s) 172, 178, 187, 199
Hpy8I GTNNAC 1 cut(s) 145
HpyCH4III ACNGT 1 cut(s) 76
HpyF10VI GCNNNNNNNGC 2 cut(s) 108, 117
HpyF3I CTNAG 1 cut(s) 177
Hsp92II CATG 2 cut(s) 135, 166
HspAI GCGC 1 cut(s) 211
KspAI GTTAAC 1 cut(s) 145
LpnPI CCDG 2 cut(s) 40, 53
MaeI CTAG 1 cut(s) 39
MaeIII GTNAC 1 cut(s) 70
MluCI AATT 2 cut(s) 30, 222
MmeI TCCRAC 2 cut(s) 59, 151
MnlI CCTC 3 cut(s) 16, 130, 199
MroXI GAANNNNTTC 1 cut(s) 30
MseI TTAA 3 cut(s) 144, 221, 226
MwoI GCNNNNNNNGC 2 cut(s) 108, 117
NlaIII CATG 2 cut(s) 135, 166
NmuCI GTSAC 1 cut(s) 70
NsbI TGCGCA 1 cut(s) 212
PdmI GAANNNNTTC 1 cut(s) 30
PfeI GAWTC 1 cut(s) 173
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SaqAI TTAA 3 cut(s) 144, 221, 226
SetI ASST 5 cut(s) 44, 59, 159, 183, 210
SfcI CTRYAG 1 cut(s) 52
Sse9I AATT 2 cut(s) 30, 222
SspMI CTAG 1 cut(s) 39
TaaI ACNGT 1 cut(s) 76
TaqI TCGA 2 cut(s) 84, 90
TasI AATT 2 cut(s) 30, 222
TfiI GAWTC 1 cut(s) 173
Tru1I TTAA 3 cut(s) 144, 221, 226
Tru9I TTAA 3 cut(s) 144, 221, 226
TscAI CASTG 1 cut(s) 79
TseFI GTSAC 1 cut(s) 70
Tsp45I GTSAC 1 cut(s) 70
TspDTI ATGAA 2 cut(s) 17, 112
TspRI CASTG 1 cut(s) 79
XmnI GAANNNNTTC 1 cut(s) 30
XspI CTAG 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.