Rh5AG266700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
35150711 .. 35152520
1810 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG266700.1

Sequence Viewer

Length: 285 bp
ATGGAGAGCAATTTGGGGGAAAGACTGATTCGAGAGAATCCCACTGCAATCCAGGTTGAATTTGAAATAGATGGTTTAGATCTAGACCGTCAGGACAAGGAACAGACAGAGAGAACAGAGGAAGCGAATAATGTTGGCAGTGGTCAGTGCCAGTATGATCAAGTGGTCCATTATGTTTCAAGTTCCAATACTGGGTTGCTTCCACTTAGCCTTAGCACAAATGTTGGCCCTGTCCAGCCACATCATAGGACAAGGGTAGTCATCAAAACTCAATACTATAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.66

Weight (kDa)

4.86

Isoelectric Point (pI)

31.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 59
AfiI CCNNNNNNNGG 1 cut(s) 192
AgsI TTSAA 3 cut(s) 59, 65, 180
AjnI CCWGG 1 cut(s) 51
AoxI GGCC 1 cut(s) 226
ApoI RAATTY 1 cut(s) 59
AspS9I GGNCC 2 cut(s) 166, 227
AvaII GGWCC 1 cut(s) 166
BccI CCATC 1 cut(s) 65
BciT130I CCWGG 1 cut(s) 53
BclI TGATCA 1 cut(s) 157
BfaI CTAG 1 cut(s) 83
BglII AGATCT 1 cut(s) 79
Bme1390I CCNGG 1 cut(s) 53
Bme18I GGWCC 1 cut(s) 166
BmgT120I GGNCC 2 cut(s) 166, 227
BmrFI CCNGG 1 cut(s) 53
BmrI ACTGGG 1 cut(s) 201
BmuI ACTGGG 1 cut(s) 201
Bpu10I CCTNAGC 1 cut(s) 212
Bsc4I CCNNNNNNNGG 1 cut(s) 192
Bse1I ACTGG 2 cut(s) 151, 196
BseBI CCWGG 1 cut(s) 53
BseLI CCNNNNNNNGG 1 cut(s) 192
BseNI ACTGG 2 cut(s) 151, 196
BshFI GGCC 1 cut(s) 228
BslI CCNNNNNNNGG 1 cut(s) 192
BsnI GGCC 1 cut(s) 228
Bsp143I GATC 2 cut(s) 79, 157
BspANI GGCC 1 cut(s) 228
BsrI ACTGG 2 cut(s) 151, 196
BssMI GATC 2 cut(s) 79, 157
Bst2UI CCWGG 1 cut(s) 53
Bst4CI ACNGT 1 cut(s) 89
BstDEI CTNAG 2 cut(s) 206, 212
BstKTI GATC 2 cut(s) 82, 160
BstMBI GATC 2 cut(s) 79, 157
BstNI CCWGG 1 cut(s) 53
BstSCI CCNGG 1 cut(s) 51
BstX2I RGATCY 1 cut(s) 79
BstYI RGATCY 1 cut(s) 79
BsuRI GGCC 1 cut(s) 228
BtsI GCAGTG 2 cut(s) 42, 145
BtsIMutI CAGTG 3 cut(s) 42, 145, 152
Cfr13I GGNCC 2 cut(s) 166, 227
CviJI RGCY 3 cut(s) 210, 228, 238
CviKI_1 RGCY 3 cut(s) 210, 228, 238
DdeI CTNAG 2 cut(s) 206, 212
DpnI GATC 2 cut(s) 81, 159
DpnII GATC 2 cut(s) 79, 157
Eco47I GGWCC 1 cut(s) 166
EcoRII CCWGG 1 cut(s) 51
FaiI YATR 4 cut(s) 156, 174, 246, 279
FbaI TGATCA 1 cut(s) 157
FspBI CTAG 1 cut(s) 83
HaeIII GGCC 1 cut(s) 228
HinfI GANTC 2 cut(s) 28, 37
Hpy188III TCNNGA 3 cut(s) 32, 83, 92
HpyCH4III ACNGT 1 cut(s) 89
HpyCH4V TGCA 1 cut(s) 47
HpyF3I CTNAG 2 cut(s) 206, 212
Ksp22I TGATCA 1 cut(s) 157
Kzo9I GATC 2 cut(s) 79, 157
LpnPI CCDG 7 cut(s) 38, 65, 77, 164, 177, 243, 248
MaeI CTAG 1 cut(s) 83
MalI GATC 2 cut(s) 81, 159
MboI GATC 2 cut(s) 79, 157
MflI RGATCY 1 cut(s) 79
MluCI AATT 3 cut(s) 10, 59, 280
MnlI CCTC 1 cut(s) 112
MspR9I CCNGG 1 cut(s) 53
MvaI CCWGG 1 cut(s) 53
NdeII GATC 2 cut(s) 79, 157
PfeI GAWTC 2 cut(s) 28, 37
Psp6I CCWGG 1 cut(s) 51
PspGI CCWGG 1 cut(s) 51
PspPI GGNCC 2 cut(s) 166, 227
PsuI RGATCY 1 cut(s) 79
Sau3AI GATC 2 cut(s) 79, 157
Sau96I GGNCC 2 cut(s) 166, 227
ScrFI CCNGG 1 cut(s) 53
SetI ASST 1 cut(s) 57
SinI GGWCC 1 cut(s) 166
Sse9I AATT 3 cut(s) 10, 59, 280
SspMI CTAG 1 cut(s) 83
StyD4I CCNGG 1 cut(s) 51
TaaI ACNGT 1 cut(s) 89
TaqI TCGA 1 cut(s) 31
TasI AATT 3 cut(s) 10, 59, 280
TfiI GAWTC 2 cut(s) 28, 37
TscAI CASTG 3 cut(s) 49, 145, 152
TspRI CASTG 3 cut(s) 49, 145, 152
VpaK11BI GGWCC 1 cut(s) 166
XapI RAATTY 1 cut(s) 59
XbaI TCTAGA 1 cut(s) 82
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.