pycom11g19190

zinc finger CCCH domain-containing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
21471873 .. 21472297
425 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g19190.2

Sequence Viewer

Length: 294 bp
ATGAACGAGATCAATACAACGGAGCAAGCAATTCCAACTAGGTACTACTGCTACAGGTGTCGCCATGCGGTCACTGTGCATGTCGAAATGAAATGCCCTTTCTGCCAAGGCGGCTTCATCCAACCATGCGAGGGTGTCTACCTAGCTATGCCATCCGAATCTGAGCATTCTGAAAGTGGTTCAGATGGAGAGAGCACCACTGGTATCTACGATTCAAATCCCAGTGGTTTTGTTACACTTGGCATTGATTCCCAAGATGTAAATAATGAGGTTGACGAGCAACGCCATGGATAA

Protein Analysis

98

Amino Acids

10.75

Weight (kDa)

4.5

Isoelectric Point (pI)

46.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 138
AciI CCGC 2 cut(s) 68, 111
AfaI GTAC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 131
AgsI TTSAA 1 cut(s) 216
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
Alw21I GWGCWC 1 cut(s) 197
Bbv12I GWGCWC 1 cut(s) 197
BccI CCATC 2 cut(s) 160, 179
BfaI CTAG 2 cut(s) 39, 143
BfmI CTRYAG 1 cut(s) 52
BglI GCCNNNNNGGC 1 cut(s) 111
BisI GCNGC 1 cut(s) 112
BlsI GCNGC 1 cut(s) 113
BmrI ACTGGG 1 cut(s) 216
BmuI ACTGGG 1 cut(s) 216
BsaBI GATNNNNATC 1 cut(s) 216
BsaJI CCNNGG 2 cut(s) 106, 286
Bsc4I CCNNNNNNNGG 1 cut(s) 131
Bse1I ACTGG 2 cut(s) 205, 222
Bse8I GATNNNNATC 1 cut(s) 216
BseDI CCNNGG 2 cut(s) 106, 286
BseGI GGATG 2 cut(s) 117, 152
BseJI GATNNNNATC 1 cut(s) 216
BseLI CCNNNNNNNGG 1 cut(s) 131
BseMII CTCAG 1 cut(s) 153
BseNI ACTGG 2 cut(s) 205, 222
BsiHKAI GWGCWC 1 cut(s) 197
BslI CCNNNNNNNGG 1 cut(s) 131
BsmI GAATGC 1 cut(s) 166
Bsp1286I GDGCHC 1 cut(s) 197
Bsp143I GATC 1 cut(s) 9
Bsp19I CCATGG 1 cut(s) 286
BspACI CCGC 2 cut(s) 68, 111
BspCNI CTCAG 1 cut(s) 154
BsrI ACTGG 2 cut(s) 205, 222
BssECI CCNNGG 2 cut(s) 106, 286
BssMI GATC 1 cut(s) 9
BssT1I CCWWGG 2 cut(s) 106, 286
Bst4CI ACNGT 1 cut(s) 76
BstC8I GCNNGC 1 cut(s) 27
BstDEI CTNAG 1 cut(s) 162
BstDSI CCRYGG 1 cut(s) 286
BstF5I GGATG 2 cut(s) 117, 152
BstKTI GATC 1 cut(s) 12
BstMBI GATC 1 cut(s) 9
BstMWI GCNNNNNNNGC 2 cut(s) 102, 111
BstNSI RCATGY 1 cut(s) 83
BstSFI CTRYAG 1 cut(s) 52
BtgI CCRYGG 1 cut(s) 286
BtsCI GGATG 2 cut(s) 117, 152
BtsIMutI CAGTG 3 cut(s) 72, 198, 229
Cac8I GCNNGC 1 cut(s) 27
Csp6I GTAC 1 cut(s) 43
CviAII CATG 4 cut(s) 65, 80, 126, 287
CviJI RGCY 2 cut(s) 114, 146
CviKI_1 RGCY 2 cut(s) 114, 146
CviQI GTAC 1 cut(s) 43
DdeI CTNAG 1 cut(s) 162
DpnI GATC 1 cut(s) 11
DpnII GATC 1 cut(s) 9
Eco130I CCWWGG 2 cut(s) 106, 286
EcoT14I CCWWGG 2 cut(s) 106, 286
ErhI CCWWGG 2 cut(s) 106, 286
FaeI CATG 4 cut(s) 68, 83, 129, 290
FaiI YATR 5 cut(s) 66, 81, 127, 149, 288
FatI CATG 4 cut(s) 64, 79, 125, 286
FblI GTMKAC 1 cut(s) 138
Fnu4HI GCNGC 1 cut(s) 112
FokI GGATG 2 cut(s) 104, 139
Fsp4HI GCNGC 1 cut(s) 112
FspBI CTAG 2 cut(s) 39, 143
GluI GCNGC 1 cut(s) 112
Hin1II CATG 4 cut(s) 68, 83, 129, 290
HincII GTYRAC 1 cut(s) 274
HindII GTYRAC 1 cut(s) 274
HinfI GANTC 3 cut(s) 158, 212, 248
Hpy166II GTNNAC 2 cut(s) 139, 274
Hpy188I TCNGA 4 cut(s) 157, 163, 172, 184
Hpy8I GTNNAC 2 cut(s) 139, 274
HpyCH4III ACNGT 1 cut(s) 76
HpyCH4V TGCA 1 cut(s) 79
HpyF10VI GCNNNNNNNGC 2 cut(s) 102, 111
HpyF3I CTNAG 1 cut(s) 162
Hsp92II CATG 4 cut(s) 68, 83, 129, 290
Kzo9I GATC 1 cut(s) 9
LmnI GCTCC 1 cut(s) 22
LpnPI CCDG 3 cut(s) 40, 186, 235
MaeI CTAG 2 cut(s) 39, 143
MaeIII GTNAC 2 cut(s) 70, 232
MalI GATC 1 cut(s) 11
MboI GATC 1 cut(s) 9
MhlI GDGCHC 1 cut(s) 197
MluCI AATT 1 cut(s) 30
MmeI TCCRAC 2 cut(s) 59, 145
MnlI CCTC 2 cut(s) 124, 262
Mva1269I GAATGC 1 cut(s) 166
MwoI GCNNNNNNNGC 2 cut(s) 102, 111
NcoI CCATGG 1 cut(s) 286
NdeII GATC 1 cut(s) 9
NlaIII CATG 4 cut(s) 68, 83, 129, 290
NmuCI GTSAC 1 cut(s) 70
NspI RCATGY 1 cut(s) 83
PctI GAATGC 1 cut(s) 166
PfeI GAWTC 3 cut(s) 158, 212, 248
PkrI GCNGC 1 cut(s) 113
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SatI GCNGC 1 cut(s) 112
Sau3AI GATC 1 cut(s) 9
SduI GDGCHC 1 cut(s) 197
SetI ASST 5 cut(s) 44, 59, 144, 148, 273
SfcI CTRYAG 1 cut(s) 52
Sse9I AATT 1 cut(s) 30
SsiI CCGC 2 cut(s) 68, 111
SspMI CTAG 2 cut(s) 39, 143
StyI CCWWGG 2 cut(s) 106, 286
TaaI ACNGT 1 cut(s) 76
TaqI TCGA 1 cut(s) 84
TasI AATT 1 cut(s) 30
TauI GCSGC 1 cut(s) 114
TfiI GAWTC 3 cut(s) 158, 212, 248
TscAI CASTG 3 cut(s) 79, 205, 229
TseFI GTSAC 1 cut(s) 70
Tsp45I GTSAC 1 cut(s) 70
TspDTI ATGAA 3 cut(s) 17, 104, 106
TspGWI ACGGA 1 cut(s) 35
TspRI CASTG 3 cut(s) 79, 205, 229
XceI RCATGY 1 cut(s) 83
XmiI GTMKAC 1 cut(s) 138
XspI CTAG 2 cut(s) 39, 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.