Prupe.2G053000_v2.0.a1

UDP-Glycosyltransferase

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Forward (+)
6148624 .. 6151209
2586 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G053000.1

Sequence Viewer

Length: 462 bp
ATGTCCACAAGAAGAAGCTTGTCAACTAGCCTTCTCACTTCCTTGATCAAGCCTGATAGGACACTTAGTGCTTCTGAATACTCCTTGCTTTCCATCAAAAGAGATGCAAGCCTGGCCTCCACTCGCTGTCGAAGGAAAGTTCGCTTCTCAGGGAAATCTGAAGATCAGATGTGCCTGATCCTCTGCTTGATTTTCTTGGCTAAGAAGATCCTGTTCTTAGTCAGTAAGGCTTCTCTTCAAACTTGGCACAAGAGGTTAGGACATCCTCATTCTACTGTGCTTAAGACTATTGTAACTAGTAATAAACTTCCTAGAGGTGTAGTGGATACAGATGAAGAAGGGGTAAAAGGAAGCCTGGTAGCTTTACCAAGAATACAATCAGTACAGTGGGGCTTAGAAAAGCTAGTAGATATTGAGTGCTGTAGTTTTTTAAGTTTGATTTCTTATGATACCTTTCATTGA

Protein Analysis

154

Amino Acids

17.15

Weight (kDa)

9.71

Isoelectric Point (pI)

43.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 172, 202
AcuI CTGAAG 1 cut(s) 180
AdeI CACNNNGTG 1 cut(s) 68
AfaI GTAC 1 cut(s) 384
AflII CTTAAG 1 cut(s) 281
AgsI TTSAA 1 cut(s) 239
AhlI ACTAGT 1 cut(s) 296
AjnI CCWGG 2 cut(s) 111, 354
AluBI AGCT 3 cut(s) 18, 362, 403
AluI AGCT 3 cut(s) 18, 362, 403
AlwI GGATC 2 cut(s) 172, 202
AoxI GGCC 1 cut(s) 114
BccI CCATC 1 cut(s) 101
BciT130I CCWGG 2 cut(s) 113, 356
BciVI GTATCC 1 cut(s) 319
BclI TGATCA 1 cut(s) 45
BcuI ACTAGT 1 cut(s) 296
BfaI CTAG 4 cut(s) 27, 297, 312, 404
BfmI CTRYAG 1 cut(s) 421
BfrI CTTAAG 1 cut(s) 281
BfuI GTATCC 1 cut(s) 319
Bme1390I CCNGG 2 cut(s) 113, 356
BmrFI CCNGG 2 cut(s) 113, 356
BmsI GCATC 1 cut(s) 94
BseBI CCWGG 2 cut(s) 113, 356
BseGI GGATG 1 cut(s) 262
BseMII CTCAG 1 cut(s) 162
BshFI GGCC 1 cut(s) 116
BsnI GGCC 1 cut(s) 116
Bsp143I GATC 4 cut(s) 45, 163, 177, 207
BspANI GGCC 1 cut(s) 116
BspCNI CTCAG 1 cut(s) 161
BspPI GGATC 2 cut(s) 172, 202
BspTI CTTAAG 1 cut(s) 281
BssMI GATC 4 cut(s) 45, 163, 177, 207
Bst2UI CCWGG 2 cut(s) 113, 356
Bst4CI ACNGT 2 cut(s) 277, 387
Bst6I CTCTTC 1 cut(s) 240
BstAFI CTTAAG 1 cut(s) 281
BstC8I GCNNGC 1 cut(s) 109
BstDEI CTNAG 5 cut(s) 65, 148, 201, 217, 394
BstF5I GGATG 1 cut(s) 262
BstKTI GATC 4 cut(s) 48, 166, 180, 210
BstMBI GATC 4 cut(s) 45, 163, 177, 207
BstMWI GCNNNNNNNGC 1 cut(s) 113
BstNI CCWGG 2 cut(s) 113, 356
BstSCI CCNGG 2 cut(s) 111, 354
BstSFI CTRYAG 1 cut(s) 421
BstX2I RGATCY 1 cut(s) 207
BstYI RGATCY 1 cut(s) 207
BsuI GTATCC 1 cut(s) 319
BsuRI GGCC 1 cut(s) 116
BtsCI GGATG 1 cut(s) 262
BtsIMutI CAGTG 1 cut(s) 392
Cac8I GCNNGC 1 cut(s) 109
Csp6I GTAC 1 cut(s) 383
CviQI GTAC 1 cut(s) 383
DdeI CTNAG 5 cut(s) 65, 148, 201, 217, 394
DpnI GATC 4 cut(s) 47, 165, 179, 209
DpnII GATC 4 cut(s) 45, 163, 177, 207
DraIII CACNNNGTG 1 cut(s) 68
Eam1104I CTCTTC 1 cut(s) 240
EarI CTCTTC 1 cut(s) 240
Eco57I CTGAAG 1 cut(s) 180
EcoRII CCWGG 2 cut(s) 111, 354
FaiI YATR 1 cut(s) 447
FbaI TGATCA 1 cut(s) 45
FokI GGATG 1 cut(s) 249
FspBI CTAG 4 cut(s) 27, 297, 312, 404
HaeIII GGCC 1 cut(s) 116
HincII GTYRAC 1 cut(s) 24
HindII GTYRAC 1 cut(s) 24
HindIII AAGCTT 1 cut(s) 16
Hpy166II GTNNAC 2 cut(s) 6, 24
Hpy188I TCNGA 3 cut(s) 76, 160, 168
Hpy8I GTNNAC 2 cut(s) 6, 24
HpyAV CCTTC 3 cut(s) 41, 126, 332
HpyCH4III ACNGT 2 cut(s) 277, 387
HpyCH4V TGCA 1 cut(s) 107
HpyF10VI GCNNNNNNNGC 1 cut(s) 113
HpyF3I CTNAG 5 cut(s) 65, 148, 201, 217, 394
Ksp22I TGATCA 1 cut(s) 45
Kzo9I GATC 4 cut(s) 45, 163, 177, 207
LpnPI CCDG 8 cut(s) 66, 98, 125, 135, 188, 224, 341, 368
LweI GCATC 1 cut(s) 94
MaeI CTAG 4 cut(s) 27, 297, 312, 404
MaeIII GTNAC 1 cut(s) 292
MalI GATC 4 cut(s) 47, 165, 179, 209
MboI GATC 4 cut(s) 45, 163, 177, 207
MboII GAAGA 5 cut(s) 24, 173, 217, 227, 347
MflI RGATCY 1 cut(s) 207
MnlI CCTC 5 cut(s) 127, 191, 246, 276, 308
MseI TTAA 2 cut(s) 282, 431
MspCI CTTAAG 1 cut(s) 281
MspR9I CCNGG 2 cut(s) 113, 356
MvaI CCWGG 2 cut(s) 113, 356
MwoI GCNNNNNNNGC 1 cut(s) 113
NdeII GATC 4 cut(s) 45, 163, 177, 207
Psp6I CCWGG 2 cut(s) 111, 354
PspGI CCWGG 2 cut(s) 111, 354
PsuI RGATCY 1 cut(s) 207
RsaI GTAC 1 cut(s) 384
RsaNI GTAC 1 cut(s) 383
SaqAI TTAA 2 cut(s) 282, 431
Sau3AI GATC 4 cut(s) 45, 163, 177, 207
ScrFI CCNGG 2 cut(s) 113, 356
SetI ASST 6 cut(s) 20, 257, 319, 364, 405, 455
SfaNI GCATC 1 cut(s) 94
SfcI CTRYAG 1 cut(s) 421
SmlI CTYRAG 1 cut(s) 281
SmoI CTYRAG 1 cut(s) 281
SpeI ACTAGT 1 cut(s) 296
SspMI CTAG 4 cut(s) 27, 297, 312, 404
StyD4I CCNGG 2 cut(s) 111, 354
TaaI ACNGT 2 cut(s) 277, 387
TaqI TCGA 1 cut(s) 130
TatI WGTACW 1 cut(s) 382
Tru1I TTAA 2 cut(s) 282, 431
Tru9I TTAA 2 cut(s) 282, 431
TscAI CASTG 1 cut(s) 392
TspDTI ATGAA 2 cut(s) 348, 446
TspRI CASTG 1 cut(s) 392
Vha464I CTTAAG 1 cut(s) 281
XspI CTAG 4 cut(s) 27, 297, 312, 404
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.