pycom07g19440

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
21799849 .. 21800303
455 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g19440.1

Sequence Viewer

Length: 246 bp
ATGGACCTCAAGACCCGGATGATGCTTTTCCAAGGGAGGTGTGAGAATGGCTTATACCTATTTCAAAGTGGCAGTGGAATATCCAAGCATCCTTTGGTTGCATTCGTAGGAGTTCATGTCTCAGTACAAAAATGGCACTCTCGTTTAGGCCATCCTGCCCTTCAAATAATCAAGTTTTTAGTTTCAAATAATCAAGTGCCAGTTCATGGCACTAATGATGTAAAGTTTTGCGAGTCATGTCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

82

Amino Acids

9.07

Weight (kDa)

9.3

Isoelectric Point (pI)

27.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
gag_pre-integrs PF13976 17 - 80 2.2e-11 GAG-pre-integrase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 206
AfaI GTAC 1 cut(s) 126
AfiI CCNNNNNNNGG 1 cut(s) 206
AgsI TTSAA 3 cut(s) 65, 164, 186
Alw26I GTCTC 1 cut(s) 124
AoxI GGCC 1 cut(s) 148
AspS9I GGNCC 1 cut(s) 4
AsuC2I CCSGG 1 cut(s) 16
AvaII GGWCC 1 cut(s) 4
BccI CCATC 1 cut(s) 159
BcnI CCSGG 1 cut(s) 16
BcoDI GTCTC 1 cut(s) 124
Bme1390I CCNGG 1 cut(s) 16
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 1 cut(s) 16
BmsI GCATC 2 cut(s) 12, 97
BpuMI CCSGG 1 cut(s) 16
BsaJI CCNNGG 1 cut(s) 31
BsaXI ACNNNNNCTCC 2 cut(s) 102, 132
Bsc4I CCNNNNNNNGG 1 cut(s) 206
Bse1I ACTGG 1 cut(s) 200
BseDI CCNNGG 1 cut(s) 31
BseGI GGATG 3 cut(s) 24, 88, 151
BseLI CCNNNNNNNGG 1 cut(s) 206
BseMII CTCAG 1 cut(s) 135
BseNI ACTGG 1 cut(s) 200
BshFI GGCC 1 cut(s) 150
BsiSI CCGG 1 cut(s) 16
BslI CCNNNNNNNGG 1 cut(s) 206
BsmAI GTCTC 1 cut(s) 124
BsmI GAATGC 1 cut(s) 101
BsnI GGCC 1 cut(s) 150
BspANI GGCC 1 cut(s) 150
BspCNI CTCAG 1 cut(s) 134
BsrI ACTGG 1 cut(s) 200
BssECI CCNNGG 1 cut(s) 31
BssT1I CCWWGG 1 cut(s) 31
BstDEI CTNAG 1 cut(s) 121
BstF5I GGATG 3 cut(s) 24, 88, 151
BstMAI GTCTC 1 cut(s) 124
BstSCI CCNGG 1 cut(s) 14
BsuRI GGCC 1 cut(s) 150
BtsCI GGATG 3 cut(s) 24, 88, 151
BtsI GCAGTG 1 cut(s) 79
BtsIMutI CAGTG 1 cut(s) 79
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 1 cut(s) 125
CviAII CATG 3 cut(s) 116, 206, 237
CviJI RGCY 2 cut(s) 51, 150
CviKI_1 RGCY 2 cut(s) 51, 150
CviQI GTAC 1 cut(s) 125
DdeI CTNAG 1 cut(s) 121
Eco130I CCWWGG 1 cut(s) 31
Eco47I GGWCC 1 cut(s) 4
EcoT14I CCWWGG 1 cut(s) 31
ErhI CCWWGG 1 cut(s) 31
FaeI CATG 3 cut(s) 119, 209, 240
FaiI YATR 5 cut(s) 55, 117, 207, 238, 244
FatI CATG 3 cut(s) 115, 205, 236
FokI GGATG 3 cut(s) 31, 75, 138
HaeIII GGCC 1 cut(s) 150
HapII CCGG 1 cut(s) 16
Hin1II CATG 3 cut(s) 119, 209, 240
HinfI GANTC 1 cut(s) 233
HpaII CCGG 1 cut(s) 16
Hpy188III TCNNGA 1 cut(s) 10
HpyAV CCTTC 1 cut(s) 170
HpyCH4V TGCA 1 cut(s) 101
HpyF3I CTNAG 1 cut(s) 121
Hsp92II CATG 3 cut(s) 119, 209, 240
LpnPI CCDG 3 cut(s) 29, 168, 213
LweI GCATC 2 cut(s) 12, 97
MlyI GAGTC 1 cut(s) 242
MnlI CCTC 2 cut(s) 17, 30
MspI CCGG 1 cut(s) 16
MspR9I CCNGG 1 cut(s) 16
Mva1269I GAATGC 1 cut(s) 101
NciI CCSGG 1 cut(s) 16
NlaIII CATG 3 cut(s) 119, 209, 240
PctI GAATGC 1 cut(s) 101
PflMI CCANNNNNTGG 1 cut(s) 206
PleI GAGTC 1 cut(s) 241
PpsI GAGTC 1 cut(s) 241
PspPI GGNCC 1 cut(s) 4
RsaI GTAC 1 cut(s) 126
RsaNI GTAC 1 cut(s) 125
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 1 cut(s) 242
ScrFI CCNGG 1 cut(s) 16
SetI ASST 3 cut(s) 9, 41, 60
SfaNI GCATC 2 cut(s) 12, 97
SinI GGWCC 1 cut(s) 4
SmlI CTYRAG 1 cut(s) 8
SmoI CTYRAG 1 cut(s) 8
StyD4I CCNGG 1 cut(s) 14
StyI CCWWGG 1 cut(s) 31
TatI WGTACW 1 cut(s) 124
TscAI CASTG 1 cut(s) 79
TspDTI ATGAA 2 cut(s) 104, 194
TspRI CASTG 1 cut(s) 79
Van91I CCANNNNNTGG 1 cut(s) 206
VpaK11BI GGWCC 1 cut(s) 4
XcmI CCANNNNNNNNNTGG 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.