RchiOBHm_Chr7g0198781

Thaumatin family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0001028
Physical Location & Seq
Reverse (-)
16786621 .. 16786860
240 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17786

Sequence Viewer

Length: 240 bp
ATGGCTGACATCAACGGACAATGCCCTAATGAGTTGAAGACTCCTGGGGGTTGCCATAATCCCTGTACTGTGTTCAAAATGGATAAGTATTGTTGCAATTCTGGGACCTGTGGACCAACTAATTTGTCAAGGTTTTTTAAGGATCGGTGTCGGGATGCTTATAGTTACCCTAAGGACGATCCGACGAGCACTTTCACTTGCCCTGGTGGGACTAATTACAGAGTTGTGTTCTGCCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Thaumatin

Protein Analysis

79

Amino Acids

8.74

Weight (kDa)

8.09

Isoelectric Point (pI)

22.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Thaumatin PF00314 2 - 79 6.2e-23 Thaumatin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 150, 173
AfaI GTAC 1 cut(s) 67
AgsI TTSAA 2 cut(s) 37, 76
AjnI CCWGG 2 cut(s) 43, 202
Alw21I GWGCWC 1 cut(s) 191
AlwI GGATC 2 cut(s) 150, 173
AspS9I GGNCC 2 cut(s) 105, 113
AvaII GGWCC 2 cut(s) 105, 113
AxyI CCTNAGG 1 cut(s) 171
BbsI GAAGAC 1 cut(s) 44
Bbv12I GWGCWC 1 cut(s) 191
BciT130I CCWGG 2 cut(s) 45, 204
Bme1390I CCNGG 2 cut(s) 45, 204
Bme18I GGWCC 2 cut(s) 105, 113
BmgT120I GGNCC 2 cut(s) 105, 113
BmiI GGNNCC 1 cut(s) 106
BmrFI CCNGG 2 cut(s) 45, 204
BmsI GCATC 1 cut(s) 145
BpiI GAAGAC 1 cut(s) 44
BsaJI CCNNGG 2 cut(s) 44, 202
Bse21I CCTNAGG 1 cut(s) 171
BseBI CCWGG 2 cut(s) 45, 204
BseDI CCNNGG 2 cut(s) 44, 202
BseGI GGATG 1 cut(s) 160
BsiHKAI GWGCWC 1 cut(s) 191
BslFI GGGAC 2 cut(s) 118, 223
BsmFI GGGAC 2 cut(s) 118, 223
Bsp1286I GDGCHC 1 cut(s) 191
Bsp143I GATC 2 cut(s) 142, 178
BspLI GGNNCC 1 cut(s) 106
BspPI GGATC 2 cut(s) 150, 173
BssECI CCNNGG 2 cut(s) 44, 202
BssMI GATC 2 cut(s) 142, 178
Bst2UI CCWGG 2 cut(s) 45, 204
Bst4CI ACNGT 1 cut(s) 70
BstDEI CTNAG 1 cut(s) 171
BstF5I GGATG 1 cut(s) 160
BstKTI GATC 2 cut(s) 145, 181
BstMBI GATC 2 cut(s) 142, 178
BstNI CCWGG 2 cut(s) 45, 204
BstSCI CCNGG 2 cut(s) 43, 202
BstV2I GAAGAC 1 cut(s) 44
Bsu36I CCTNAGG 1 cut(s) 171
BtsCI GGATG 1 cut(s) 160
Cfr13I GGNCC 2 cut(s) 105, 113
Csp6I GTAC 1 cut(s) 66
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
CviQI GTAC 1 cut(s) 66
DdeI CTNAG 1 cut(s) 171
DpnI GATC 2 cut(s) 144, 180
DpnII GATC 2 cut(s) 142, 178
Eco47I GGWCC 2 cut(s) 105, 113
Eco81I CCTNAGG 1 cut(s) 171
EcoO109I RGGNCCY 1 cut(s) 105
EcoRII CCWGG 2 cut(s) 43, 202
FaiI YATR 2 cut(s) 57, 162
FaqI GGGAC 2 cut(s) 118, 223
FokI GGATG 1 cut(s) 167
HinfI GANTC 1 cut(s) 40
Hpy166II GTNNAC 1 cut(s) 113
Hpy188I TCNGA 1 cut(s) 183
Hpy188III TCNNGA 1 cut(s) 152
Hpy8I GTNNAC 1 cut(s) 113
Hpy99I CGWCG 1 cut(s) 187
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4V TGCA 1 cut(s) 96
HpyF3I CTNAG 1 cut(s) 171
Kzo9I GATC 2 cut(s) 142, 178
LpnPI CCDG 7 cut(s) 30, 57, 76, 87, 121, 189, 216
LweI GCATC 1 cut(s) 145
MaeIII GTNAC 1 cut(s) 164
MalI GATC 2 cut(s) 144, 180
MboI GATC 2 cut(s) 142, 178
MboII GAAGA 1 cut(s) 49
MhlI GDGCHC 1 cut(s) 191
MluCI AATT 3 cut(s) 97, 121, 214
MlyI GAGTC 1 cut(s) 34
MmeI TCCRAC 1 cut(s) 206
MseI TTAA 1 cut(s) 138
MspR9I CCNGG 2 cut(s) 45, 204
MvaI CCWGG 2 cut(s) 45, 204
NdeII GATC 2 cut(s) 142, 178
NlaIV GGNNCC 1 cut(s) 106
PleI GAGTC 1 cut(s) 34
PpsI GAGTC 1 cut(s) 34
PpuMI RGGWCCY 1 cut(s) 105
Psp5II RGGWCCY 1 cut(s) 105
Psp6I CCWGG 2 cut(s) 43, 202
PspGI CCWGG 2 cut(s) 43, 202
PspN4I GGNNCC 1 cut(s) 106
PspPI GGNCC 2 cut(s) 105, 113
PspPPI RGGWCCY 1 cut(s) 105
RsaI GTAC 1 cut(s) 67
RsaNI GTAC 1 cut(s) 66
SaqAI TTAA 1 cut(s) 138
Sau3AI GATC 2 cut(s) 142, 178
Sau96I GGNCC 2 cut(s) 105, 113
SchI GAGTC 1 cut(s) 34
ScrFI CCNGG 2 cut(s) 45, 204
SduI GDGCHC 1 cut(s) 191
SetI ASST 2 cut(s) 110, 134
SfaNI GCATC 1 cut(s) 145
SinI GGWCC 2 cut(s) 105, 113
Sse9I AATT 3 cut(s) 97, 121, 214
StyD4I CCNGG 2 cut(s) 43, 202
TaaI ACNGT 1 cut(s) 70
TasI AATT 3 cut(s) 97, 121, 214
TatI WGTACW 1 cut(s) 65
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TspGWI ACGGA 1 cut(s) 30
VpaK11BI GGWCC 2 cut(s) 105, 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.