Prupe.5G093800_v2.0.a1

UDP-Glycosyltransferase

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
Physical Location & Seq
Forward (+)
10376653 .. 10378375
1723 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G093800.1

Sequence Viewer

Length: 255 bp
ATGTCCACAAGAAGAAGCTTGTCAACTAGCCTTCTCACTTCCTTGATCAAGCCTGATAGGACACTTAGTGCTTCTGAATACTCCTTGCTTTCCATCAAAAGAGATGCAAGCCTGGCCTCCACTCGCTGTCGAAGGAAAGTTCGCTTCTCAGGGAAATCTGAAGATCAGATTAGTGATAGCTACCCTCAGGATGACAAAACAAGCTTATTTACATGCCCTGGCGGGACGAACTATAAGGTTGTGTTCTGCCCATGA

Protein Analysis

85

Amino Acids

9.36

Weight (kDa)

9.6

Isoelectric Point (pI)

47.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 222
AcuI CTGAAG 1 cut(s) 180
AdeI CACNNNGTG 1 cut(s) 68
AjnI CCWGG 2 cut(s) 111, 217
AluBI AGCT 3 cut(s) 18, 180, 204
AluI AGCT 3 cut(s) 18, 180, 204
AoxI GGCC 1 cut(s) 114
AxyI CCTNAGG 1 cut(s) 186
BccI CCATC 1 cut(s) 101
BciT130I CCWGG 2 cut(s) 113, 219
BclI TGATCA 1 cut(s) 45
BfaI CTAG 1 cut(s) 27
Bme1390I CCNGG 2 cut(s) 113, 219
BmrFI CCNGG 2 cut(s) 113, 219
BmsI GCATC 1 cut(s) 94
BsaJI CCNNGG 1 cut(s) 217
Bse21I CCTNAGG 1 cut(s) 186
BseBI CCWGG 2 cut(s) 113, 219
BseDI CCNNGG 1 cut(s) 217
BseGI GGATG 1 cut(s) 196
BseMII CTCAG 2 cut(s) 162, 200
BshFI GGCC 1 cut(s) 116
BslFI GGGAC 1 cut(s) 238
BsmFI GGGAC 1 cut(s) 238
BsnI GGCC 1 cut(s) 116
Bsp143I GATC 2 cut(s) 45, 163
BspACI CCGC 1 cut(s) 222
BspANI GGCC 1 cut(s) 116
BspCNI CTCAG 2 cut(s) 161, 199
BssECI CCNNGG 1 cut(s) 217
BssMI GATC 2 cut(s) 45, 163
Bst2UI CCWGG 2 cut(s) 113, 219
BstC8I GCNNGC 1 cut(s) 109
BstDEI CTNAG 3 cut(s) 65, 148, 186
BstF5I GGATG 1 cut(s) 196
BstKTI GATC 2 cut(s) 48, 166
BstMBI GATC 2 cut(s) 45, 163
BstMWI GCNNNNNNNGC 1 cut(s) 113
BstNI CCWGG 2 cut(s) 113, 219
BstNSI RCATGY 1 cut(s) 216
BstSCI CCNGG 2 cut(s) 111, 217
Bsu36I CCTNAGG 1 cut(s) 186
BsuRI GGCC 1 cut(s) 116
BtsCI GGATG 1 cut(s) 196
Cac8I GCNNGC 1 cut(s) 109
CviAII CATG 2 cut(s) 213, 252
CviJI RGCY 7 cut(s) 18, 30, 52, 111, 116, 180, 204
CviKI_1 RGCY 7 cut(s) 18, 30, 52, 111, 116, 180, 204
DdeI CTNAG 3 cut(s) 65, 148, 186
DpnI GATC 2 cut(s) 47, 165
DpnII GATC 2 cut(s) 45, 163
DraIII CACNNNGTG 1 cut(s) 68
Eco57I CTGAAG 1 cut(s) 180
Eco81I CCTNAGG 1 cut(s) 186
EcoRII CCWGG 2 cut(s) 111, 217
FaeI CATG 2 cut(s) 216, 255
FaiI YATR 3 cut(s) 214, 234, 253
FaqI GGGAC 1 cut(s) 238
FatI CATG 2 cut(s) 212, 251
FauI CCCGC 1 cut(s) 215
FbaI TGATCA 1 cut(s) 45
FokI GGATG 1 cut(s) 203
FspBI CTAG 1 cut(s) 27
HaeIII GGCC 1 cut(s) 116
Hin1II CATG 2 cut(s) 216, 255
HincII GTYRAC 1 cut(s) 24
HindII GTYRAC 1 cut(s) 24
HindIII AAGCTT 2 cut(s) 16, 202
Hpy166II GTNNAC 2 cut(s) 6, 24
Hpy188I TCNGA 3 cut(s) 76, 160, 168
Hpy188III TCNNGA 1 cut(s) 188
Hpy8I GTNNAC 2 cut(s) 6, 24
HpyAV CCTTC 2 cut(s) 41, 126
HpyCH4V TGCA 1 cut(s) 107
HpyF10VI GCNNNNNNNGC 1 cut(s) 113
HpyF3I CTNAG 3 cut(s) 65, 148, 186
Hsp92II CATG 2 cut(s) 216, 255
Ksp22I TGATCA 1 cut(s) 45
Kzo9I GATC 2 cut(s) 45, 163
LpnPI CCDG 7 cut(s) 66, 98, 125, 135, 173, 204, 231
LweI GCATC 1 cut(s) 94
MaeI CTAG 1 cut(s) 27
MalI GATC 2 cut(s) 47, 165
MboI GATC 2 cut(s) 45, 163
MboII GAAGA 2 cut(s) 24, 173
MnlI CCTC 2 cut(s) 127, 195
MspR9I CCNGG 2 cut(s) 113, 219
MvaI CCWGG 2 cut(s) 113, 219
MwoI GCNNNNNNNGC 1 cut(s) 113
NdeII GATC 2 cut(s) 45, 163
NlaIII CATG 2 cut(s) 216, 255
NspI RCATGY 1 cut(s) 216
Psp6I CCWGG 2 cut(s) 111, 217
PspGI CCWGG 2 cut(s) 111, 217
Sau3AI GATC 2 cut(s) 45, 163
ScrFI CCNGG 2 cut(s) 113, 219
SetI ASST 4 cut(s) 20, 182, 206, 240
SfaNI GCATC 1 cut(s) 94
SsiI CCGC 1 cut(s) 222
SspMI CTAG 1 cut(s) 27
StyD4I CCNGG 2 cut(s) 111, 217
TaqI TCGA 1 cut(s) 130
XceI RCATGY 1 cut(s) 216
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.