Prupe.6G008200_v2.0.a1

UDP-Glycosyltransferase

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
669209 .. 669740
532 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G008200.1

Sequence Viewer

Length: 363 bp
ATGGAAGTTTTGGCTCATGGCCTAGTGGGTGGGTTTTGGAGCCATTGTGGTTTGTCTGAAGGGGTTCCGATGTTATGCAGGCTGTGCTTTAGCGATAAGAAGGTGAATGCAAGGTATGTGAGCGAAGTATTTAAAATAGGGATACAATTGGAGAATGAATTAGAGAGGGCAGAGATAGAGAGAGGGGTTAGAAAACTTATGGTAGATGAGGATGGGAAGGGAATGAGGGTGAGGGCCAGGGAGTTGAAAGAGAAAATAGATGTCAGTATGAAGGGTGGCTCTACCTACCATTCCATGAAATCAGCTTGTGGAGCTTATAAGACTTTACATTTCAAAGTAGTTGAAGCAACAACATCAAGGTGA

Protein Analysis

121

Amino Acids

13.45

Weight (kDa)

8.95

Isoelectric Point (pI)

11.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 318
AcuI CTGAAG 1 cut(s) 78
AgsI TTSAA 3 cut(s) 247, 334, 344
AjnI CCWGG 1 cut(s) 236
AluBI AGCT 2 cut(s) 305, 314
AluI AGCT 2 cut(s) 305, 314
AoxI GGCC 2 cut(s) 19, 234
Asp700I GAANNNNTTC 1 cut(s) 63
AspS9I GGNCC 1 cut(s) 234
AsuHPI GGTGA 2 cut(s) 115, 241
BccI CCATC 1 cut(s) 206
BciT130I CCWGG 1 cut(s) 238
BciVI GTATCC 1 cut(s) 135
BfaI CTAG 1 cut(s) 23
BfuI GTATCC 1 cut(s) 135
Bme1390I CCNGG 1 cut(s) 238
BmgT120I GGNCC 1 cut(s) 234
BmiI GGNNCC 2 cut(s) 41, 66
BmrFI CCNGG 1 cut(s) 238
BsaJI CCNNGG 1 cut(s) 237
BsaXI ACNNNNNCTCC 2 cut(s) 31, 61
BseBI CCWGG 1 cut(s) 238
BseDI CCNNGG 1 cut(s) 237
BseGI GGATG 1 cut(s) 217
BshFI GGCC 2 cut(s) 21, 236
BsmI GAATGC 1 cut(s) 112
BsnI GGCC 2 cut(s) 21, 236
BspANI GGCC 2 cut(s) 21, 236
BspLI GGNNCC 2 cut(s) 41, 66
BssECI CCNNGG 1 cut(s) 237
Bst2UI CCWGG 1 cut(s) 238
BstAPI GCANNNNNTGC 1 cut(s) 84
BstC8I GCNNGC 1 cut(s) 80
BstF5I GGATG 1 cut(s) 217
BstMWI GCNNNNNNNGC 2 cut(s) 84, 311
BstNI CCWGG 1 cut(s) 238
BstSCI CCNGG 1 cut(s) 236
BsuI GTATCC 1 cut(s) 135
BsuRI GGCC 2 cut(s) 21, 236
BtsCI GGATG 1 cut(s) 217
Cac8I GCNNGC 1 cut(s) 80
Cfr13I GGNCC 1 cut(s) 234
CviAII CATG 2 cut(s) 17, 295
CviJI RGCY 8 cut(s) 14, 21, 42, 82, 236, 279, 305, 314
CviKI_1 RGCY 8 cut(s) 14, 21, 42, 82, 236, 279, 305, 314
DraI TTTAAA 1 cut(s) 133
Eco57I CTGAAG 1 cut(s) 78
EcoRII CCWGG 1 cut(s) 236
FaeI CATG 2 cut(s) 20, 298
FaiI YATR 7 cut(s) 18, 76, 117, 200, 269, 296, 318
FatI CATG 2 cut(s) 16, 294
FokI GGATG 1 cut(s) 224
FspBI CTAG 1 cut(s) 23
HaeIII GGCC 2 cut(s) 21, 236
Hin1II CATG 2 cut(s) 20, 298
HphI GGTGA 2 cut(s) 115, 241
Hpy188I TCNGA 2 cut(s) 58, 69
HpyAV CCTTC 4 cut(s) 53, 94, 211, 265
HpyCH4V TGCA 2 cut(s) 78, 110
HpyF10VI GCNNNNNNNGC 2 cut(s) 84, 311
Hsp92II CATG 2 cut(s) 20, 298
LmnI GCTCC 2 cut(s) 39, 311
LpnPI CCDG 3 cut(s) 64, 223, 250
MaeI CTAG 1 cut(s) 23
MfeI CAATTG 1 cut(s) 146
MluCI AATT 2 cut(s) 146, 158
MnlI CCTC 5 cut(s) 159, 176, 202, 219, 225
MroXI GAANNNNTTC 1 cut(s) 63
MseI TTAA 1 cut(s) 132
MslI CAYNNNNRTG 1 cut(s) 358
MspR9I CCNGG 1 cut(s) 238
MunI CAATTG 1 cut(s) 146
Mva1269I GAATGC 1 cut(s) 112
MvaI CCWGG 1 cut(s) 238
MwoI GCNNNNNNNGC 2 cut(s) 84, 311
NlaIII CATG 2 cut(s) 20, 298
NlaIV GGNNCC 2 cut(s) 41, 66
PctI GAATGC 1 cut(s) 112
PdmI GAANNNNTTC 1 cut(s) 63
PsiI TTATAA 1 cut(s) 318
Psp6I CCWGG 1 cut(s) 236
PspGI CCWGG 1 cut(s) 236
PspN4I GGNNCC 2 cut(s) 41, 66
PspPI GGNCC 1 cut(s) 234
RseI CAYNNNNRTG 1 cut(s) 358
SaqAI TTAA 1 cut(s) 132
Sau96I GGNCC 1 cut(s) 234
ScrFI CCNGG 1 cut(s) 238
SetI ASST 6 cut(s) 105, 116, 287, 307, 316, 362
SgeI CNNG 8 cut(s) 29, 35, 91, 123, 249, 250, 307, 318
SmiMI CAYNNNNRTG 1 cut(s) 358
Sse9I AATT 2 cut(s) 146, 158
SspMI CTAG 1 cut(s) 23
StyD4I CCNGG 1 cut(s) 236
TasI AATT 2 cut(s) 146, 158
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
TspDTI ATGAA 3 cut(s) 171, 284, 311
XmnI GAANNNNTTC 1 cut(s) 63
XspI CTAG 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.