Prupe.7G064500_v2.0.a1

Protein FAR1-RELATED SEQUENCE

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Forward (+)
10298402 .. 10298791
390 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G064500.1

Sequence Viewer

Length: 390 bp
ATGCCCATGAATGATTTAGAGGGGAGGGAGTTTGCAAATTTTGAGGAAGCAAAAAGATCTTACTCGAACTATAGTCTTGCAATTGGTTTTACCATAAGAAGAAGCCGTTTAAGACGTAGCAAGGGTGGGGTTGTGACAAATAGACAATGGTTGTGCTCAAAAGAAGGGAGCATATCAAAGAAATGGACAAATAGAGAGGATATAGTTCGTACACTAAGGAAAAAGACCAGAGAGAATCATTACACCGCATTTGCTGTGCAATATTGTCATAAACGAGATGTTTATATTGTGAATAAATTTGTAAATGAGCACATTCACCGACTTGCTCACTCACATAAGGTGCTTTTTCTTCGCTCCCACCGATGTGTTAAGGAATCCGACATTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

130

Amino Acids

15.36

Weight (kDa)

10.21

Isoelectric Point (pI)

59.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 246
AcsI RAATTY 2 cut(s) 37, 296
AfaI GTAC 1 cut(s) 211
AleI CACNNNNGTG 1 cut(s) 363
Alw21I GWGCWC 2 cut(s) 158, 312
ApoI RAATTY 2 cut(s) 37, 296
AsuHPI GGTGA 1 cut(s) 308
Bbv12I GWGCWC 2 cut(s) 158, 312
BceAI ACGGC 1 cut(s) 90
BfmI CTRYAG 1 cut(s) 70
BglII AGATCT 1 cut(s) 56
Bse3DI GCAATG 1 cut(s) 381
BseMI GCAATG 1 cut(s) 381
BsiHKAI GWGCWC 2 cut(s) 158, 312
Bsp1286I GDGCHC 2 cut(s) 158, 312
Bsp143I GATC 1 cut(s) 56
BspACI CCGC 1 cut(s) 246
BsrDI GCAATG 1 cut(s) 381
BssMI GATC 1 cut(s) 56
BstDEI CTNAG 1 cut(s) 215
BstKTI GATC 1 cut(s) 59
BstMBI GATC 1 cut(s) 56
BstSFI CTRYAG 1 cut(s) 70
BstX2I RGATCY 1 cut(s) 56
BstYI RGATCY 1 cut(s) 56
Csp6I GTAC 1 cut(s) 210
CviAII CATG 1 cut(s) 7
CviJI RGCY 1 cut(s) 105
CviKI_1 RGCY 1 cut(s) 105
CviQI GTAC 1 cut(s) 210
DdeI CTNAG 1 cut(s) 215
DpnI GATC 1 cut(s) 58
DpnII GATC 1 cut(s) 56
FaeI CATG 1 cut(s) 10
FaiI YATR 9 cut(s) 8, 72, 95, 173, 203, 270, 285, 336, 388
FatI CATG 1 cut(s) 6
Hin1II CATG 1 cut(s) 10
HinfI GANTC 2 cut(s) 235, 374
HphI GGTGA 1 cut(s) 308
Hpy166II GTNNAC 1 cut(s) 212
Hpy188I TCNGA 1 cut(s) 379
Hpy8I GTNNAC 1 cut(s) 212
HpyAV CCTTC 1 cut(s) 158
HpyCH4IV ACGT 1 cut(s) 115
HpyCH4V TGCA 4 cut(s) 35, 80, 259, 386
HpyF3I CTNAG 1 cut(s) 215
HpySE526I ACGT 1 cut(s) 115
Hsp92II CATG 1 cut(s) 10
Kzo9I GATC 1 cut(s) 56
LmnI GCTCC 2 cut(s) 168, 359
LpnPI CCDG 1 cut(s) 241
MaeII ACGT 1 cut(s) 115
MaeIII GTNAC 1 cut(s) 133
MalI GATC 1 cut(s) 58
MboI GATC 1 cut(s) 56
MboII GAAGA 2 cut(s) 111, 341
MfeI CAATTG 1 cut(s) 81
MflI RGATCY 1 cut(s) 56
MhlI GDGCHC 2 cut(s) 158, 312
MluCI AATT 3 cut(s) 37, 81, 296
MnlI CCTC 4 cut(s) 13, 18, 37, 190
MseI TTAA 2 cut(s) 110, 369
MslI CAYNNNNRTG 1 cut(s) 363
MunI CAATTG 1 cut(s) 81
NdeII GATC 1 cut(s) 56
NlaIII CATG 1 cut(s) 10
NmuCI GTSAC 1 cut(s) 133
OliI CACNNNNGTG 1 cut(s) 363
PcsI WCGNNNNNNNCGW 1 cut(s) 358
PfeI GAWTC 2 cut(s) 235, 374
PsuI RGATCY 1 cut(s) 56
RsaI GTAC 1 cut(s) 211
RsaNI GTAC 1 cut(s) 210
RseI CAYNNNNRTG 1 cut(s) 363
SaqAI TTAA 2 cut(s) 110, 369
Sau3AI GATC 1 cut(s) 56
SduI GDGCHC 2 cut(s) 158, 312
SetI ASST 2 cut(s) 118, 342
SfcI CTRYAG 1 cut(s) 70
SgeI CNNG 7 cut(s) 19, 76, 89, 133, 240, 287, 335
SmiMI CAYNNNNRTG 1 cut(s) 363
Sse9I AATT 3 cut(s) 37, 81, 296
SsiI CCGC 1 cut(s) 246
SspI AATATT 1 cut(s) 263
TaiI ACGT 1 cut(s) 118
TaqI TCGA 1 cut(s) 65
TasI AATT 3 cut(s) 37, 81, 296
TfiI GAWTC 2 cut(s) 235, 374
Tru1I TTAA 2 cut(s) 110, 369
Tru9I TTAA 2 cut(s) 110, 369
TseFI GTSAC 1 cut(s) 133
Tsp45I GTSAC 1 cut(s) 133
TspDTI ATGAA 1 cut(s) 23
XapI RAATTY 2 cut(s) 37, 296
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.