Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010172.1

Orthogroup ID

OG0001462

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 2530

Gene Structure 2530 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010172.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 872 bp

gggccccagattcagtggaaaatggagaaaccaatggagcgaaggaaggcaacaaccatccttcaaatggcccagcagatgcgaaaactaaccaaccatcattagagccggaaggtcaacctccagttgggttgggcagaggcttagctgcactggatggcaagaaacaaaagtcgaaagccaaagctgcatcaagattgaaggttgatgacgtgaagaccatgacgttcaagacagtaaaggacgtagagaagttctattctgcctattccttggcacttggctttggatttaggaaggataccaagggagaggctgaaggtatgatctgtaggagacaatggctttgcaacaagcaaggggctcgagctaaaaagcggttcgcaatggacggaaggggtcgtactcctcggagaattacaaggctaaattcaagactgccttcattcgttcacattgaaatgtcaacaaatcagacttggcccatgcaaatacaatgtcagtctgaagtttcaatcagaccttgccatgcgtatgagtacatggtggagcaggcggggggatatgagatagtgagatttaccatgaaggacctgtacaacaagctcgaccaacaacggcgcaccacttcctttgagagtgactctgaaggcgcacttgcctacatgaccgctctggcagcacaagacacatacttctactgcaggttcaatgtagatgtagaaaataggttagcaaacatgttttggcgagatgggcatgcagttgttgattttatgcgttacggggatgtgttgatatttgatagtacaaacaaaaccaatgtttacaaaaagccattggttttgtttgttgggtcaaacaatcattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FAR1 MULE SWIM

Protein Analysis

289

Amino Acids

32.61

Weight (kDa)

9.31

Isoelectric Point (pI)

34.62

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001462)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g04881 FvH4_4g08902 FvH4_4g10122 FvH4_4g10571 FvH4_5g29993 FvH4_6g40675 FvH4_7g03536
prunus_persica	Prupe.7G064500_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0118661 RchiOBHm_Chr2g0118731
rosa_laevigata	RLG00000018416
rosa_multiflora	Rmu_co8058120.1_g000001 Rmu_co8418271.1_g000001 Rmu_sc0001814.1_g000033 Rmu_sc0002091.1_g000004 Rmu_sc0002831.1_g000006 Rmu_sc0002831.1_g000036 Rmu_sc0003776.1_g000023 Rmu_sc0004399.1_g000009 Rmu_sc0004702.1_g000008 Rmu_sc0005580.1_g000009 Rmu_sc0007609.1_g000001 Rmu_sc0010172.1_g000001 Rmu_sc0011109.1_g000005
rosa_roxburghii	Rroxscaffold_2G00124800 Rroxscaffold_2G00124860 Rroxscaffold_2G00124910 Rroxscaffold_2G00125590
rosa_rugosa	Rorug02G0217900 Rorug02G0218000 Rorug02G0218100 Rorug02G0218200 Rorug02G0218300 Rorug04G0069100 Rorug04G0112100 Rorug05G0540900 Rorug05G0555100 Rorug07G0226600 Rorug07G0259000
rosa_samantha	Rh1CG249400 Rh2AG274600 Rh2AG274900 Rh2CG318700 Rh2DG282100 Rh2DG282300 Rh2DG301400
rosa_wichuraiana	Rw0G002340 Rw1G023500 Rw2G021840 Rw2G021870 Rw2G021910 Rw2G034530

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	695
AccBSI	CCGCTC	1 cut(s)	673
AciI	CCGC	3 cut(s)	378, 556, 671
AcsI	RAATTY	1 cut(s)	429
AcuI	CTGAAG	3 cut(s)	338, 527, 668
AfaI	GTAC	4 cut(s)	405, 541, 598, 810
AfiI	CCNNNNNNNGG	2 cut(s)	67, 127
AflIII	ACRYGT	1 cut(s)	740
AgsI	TTSAA	7 cut(s)	65, 201, 231, 434, 460, 515, 711
AjiI	CACGTC	1 cut(s)	213
AluBI	AGCT	4 cut(s)	148, 187, 370, 606
AluI	AGCT	4 cut(s)	148, 187, 370, 606
Alw26I	GTCTC	1 cut(s)	330
Ama87I	CYCGRG	1 cut(s)	365
AoxI	GGCC	3 cut(s)	2, 69, 481
ApaI	GGGCCC	1 cut(s)	6
ApeKI	GCWGC	3 cut(s)	148, 187, 679
ApoI	RAATTY	1 cut(s)	429
ArsI	GACNNNNNNTTYG	4 cut(s)	329, 361, 483, 515
AspLEI	GCGC	2 cut(s)	623, 655
AspS9I	GGNCC	5 cut(s)	2, 3, 70, 482, 591
AvaI	CYCGRG	1 cut(s)	365
AvaII	GGWCC	1 cut(s)	591
BaeGI	GKGCMC	1 cut(s)	6
BanII	GRGCYC	2 cut(s)	6, 366
BarI	GAAGNNNNNNTAC	4 cut(s)	387, 419, 580, 612
BbsI	GAAGAC	1 cut(s)	223
BbvI	GCAGC	3 cut(s)	135, 174, 691
BccI	CCATC	4 cut(s)	65, 105, 151, 748
BceAI	ACGGC	1 cut(s)	634
BcgI	CGANNNNNNTGC	2 cut(s)	346, 380
BciVI	GTATCC	1 cut(s)	294
BcoDI	GTCTC	1 cut(s)	330
BfmI	CTRYAG	2 cut(s)	330, 702
BfuAI	ACCTGC	1 cut(s)	695
BfuI	GTATCC	1 cut(s)	294
BisI	GCNGC	3 cut(s)	149, 188, 680
BlpI	GCTNAGC	1 cut(s)	144
BlsI	GCNGC	3 cut(s)	150, 189, 681
Bme18I	GGWCC	1 cut(s)	591
BmeT110I	CYCGRG	1 cut(s)	365
BmgBI	CACGTC	1 cut(s)	213
BmgT120I	GGNCC	5 cut(s)	2, 3, 70, 482, 591
BmiI	GGNNCC	2 cut(s)	4, 5
BmsI	GCATC	2 cut(s)	69, 199
BpiI	GAAGAC	1 cut(s)	223
BplI	GAGNNNNNCTC	2 cut(s)	628, 660
BpmI	CTGGAG	1 cut(s)	107
Bpu1102I	GCTNAGC	1 cut(s)	144
BsaJI	CCNNGG	3 cut(s)	272, 305, 409
Bsc4I	CCNNNNNNNGG	2 cut(s)	67, 127
Bse1I	ACTGG	2 cut(s)	124, 158
Bse3DI	GCAATG	1 cut(s)	392
BseDI	CCNNGG	3 cut(s)	272, 305, 409
BseGI	GGATG	3 cut(s)	57, 162, 795
BseLI	CCNNNNNNNGG	2 cut(s)	67, 127
BseMI	GCAATG	1 cut(s)	392
BseNI	ACTGG	2 cut(s)	124, 158
BseRI	GAGGAG	1 cut(s)	398
BseSI	GKGCMC	1 cut(s)	6
BseXI	GCAGC	3 cut(s)	135, 174, 691
BseYI	CCCAGC	1 cut(s)	72
BsgI	GTGCAG	1 cut(s)	134
BshFI	GGCC	3 cut(s)	4, 71, 483
BsiHKCI	CYCGRG	1 cut(s)	365
BsiSI	CCGG	1 cut(s)	109
BslI	CCNNNNNNNGG	2 cut(s)	67, 127
BsmAI	GTCTC	1 cut(s)	330
BsnI	GGCC	3 cut(s)	4, 71, 483
BsoBI	CYCGRG	1 cut(s)	365
Bsp120I	GGGCCC	1 cut(s)	2
Bsp1286I	GDGCHC	2 cut(s)	6, 366
Bsp1407I	TGTACA	1 cut(s)	596
Bsp143I	GATC	1 cut(s)	326
Bsp1720I	GCTNAGC	1 cut(s)	144
BspACI	CCGC	3 cut(s)	378, 556, 671
BspANI	GGCC	3 cut(s)	4, 71, 483
BspLI	GGNNCC	2 cut(s)	4, 5
BspMAI	CTGCAG	1 cut(s)	706
BspMI	ACCTGC	1 cut(s)	695
BsrBI	CCGCTC	1 cut(s)	673
BsrDI	GCAATG	1 cut(s)	392
BsrGI	TGTACA	1 cut(s)	596
BsrI	ACTGG	2 cut(s)	124, 158
BssECI	CCNNGG	3 cut(s)	272, 305, 409
BssMI	GATC	1 cut(s)	326
BssT1I	CCWWGG	2 cut(s)	272, 305
Bst4CI	ACNGT	1 cut(s)	237
BstAUI	TGTACA	1 cut(s)	596
BstC8I	GCNNGC	2 cut(s)	554, 761
BstDEI	CTNAG	1 cut(s)	144
BstF5I	GGATG	3 cut(s)	57, 162, 795
BstHHI	GCGC	2 cut(s)	623, 655
BstKTI	GATC	1 cut(s)	329
BstMAI	GTCTC	1 cut(s)	330
BstMBI	GATC	1 cut(s)	326
BstMWI	GCNNNNNNNGC	3 cut(s)	187, 679, 756
BstNSI	RCATGY	2 cut(s)	744, 763
BstSFI	CTRYAG	2 cut(s)	330, 702
BstSLI	GKGCMC	1 cut(s)	6
BstV1I	GCAGC	3 cut(s)	135, 174, 691
BstV2I	GAAGAC	1 cut(s)	223
BsuI	GTATCC	1 cut(s)	294
BsuRI	GGCC	3 cut(s)	4, 71, 483
BtrI	CACGTC	1 cut(s)	213
BtsCI	GGATG	3 cut(s)	57, 162, 795
BtsIMutI	CAGTG	2 cut(s)	20, 151
BveI	ACCTGC	1 cut(s)	695
Cac8I	GCNNGC	2 cut(s)	554, 761
CfoI	GCGC	2 cut(s)	623, 655
Cfr13I	GGNCC	5 cut(s)	2, 3, 70, 482, 591
Csp6I	GTAC	4 cut(s)	404, 540, 597, 809
CspCI	CAANNNNNGTGG	2 cut(s)	615, 650
CviAII	CATG	8 cut(s)	222, 486, 529, 543, 585, 666, 741, 760
CviQI	GTAC	4 cut(s)	404, 540, 597, 809
DdeI	CTNAG	1 cut(s)	144
DpnI	GATC	1 cut(s)	328
DpnII	GATC	1 cut(s)	326
Eco130I	CCWWGG	2 cut(s)	272, 305
Eco24I	GRGCYC	2 cut(s)	6, 366
Eco47I	GGWCC	1 cut(s)	591
Eco57I	CTGAAG	3 cut(s)	338, 527, 668
Eco88I	CYCGRG	1 cut(s)	365
EcoO109I	RGGNCCY	2 cut(s)	3, 591
EcoT14I	CCWWGG	2 cut(s)	272, 305
EcoT38I	GRGCYC	2 cut(s)	6, 366
ErhI	CCWWGG	2 cut(s)	272, 305
FaeI	CATG	8 cut(s)	225, 489, 532, 546, 588, 669, 744, 763
FalI	AAGNNNNNCTT	4 cut(s)	426, 458, 641, 673
FatI	CATG	8 cut(s)	221, 485, 528, 542, 584, 665, 740, 759
FauI	CCCGC	1 cut(s)	549
Fnu4HI	GCNGC	3 cut(s)	149, 188, 680
FokI	GGATG	3 cut(s)	44, 169, 802
FriOI	GRGCYC	2 cut(s)	6, 366
Fsp4HI	GCNGC	3 cut(s)	149, 188, 680
GlaI	GCGC	2 cut(s)	622, 654
GluI	GCNGC	3 cut(s)	149, 188, 680
GsaI	CCCAGC	1 cut(s)	76
GsuI	CTGGAG	1 cut(s)	107
HaeIII	GGCC	3 cut(s)	4, 71, 483
HapII	CCGG	1 cut(s)	109
HhaI	GCGC	2 cut(s)	623, 655
Hin1II	CATG	8 cut(s)	225, 489, 532, 546, 588, 669, 744, 763
Hin6I	GCGC	2 cut(s)	621, 653
HinP1I	GCGC	2 cut(s)	621, 653
HincII	GTYRAC	2 cut(s)	118, 467
HindII	GTYRAC	2 cut(s)	118, 467
HinfI	GANTC	2 cut(s)	10, 643
HpaII	CCGG	1 cut(s)	109
Hpy166II	GTNNAC	4 cut(s)	118, 453, 467, 828
Hpy188I	TCNGA	5 cut(s)	413, 476, 507, 520, 648
Hpy188III	TCNNGA	3 cut(s)	194, 231, 434
Hpy8I	GTNNAC	4 cut(s)	118, 453, 467, 828
HpyCH4III	ACNGT	1 cut(s)	237
HpyCH4IV	ACGT	3 cut(s)	212, 226, 245
HpyCH4V	TGCA	6 cut(s)	151, 190, 350, 489, 704, 763
HpyF10VI	GCNNNNNNNGC	3 cut(s)	187, 679, 756
HpyF3I	CTNAG	1 cut(s)	144
HpySE526I	ACGT	3 cut(s)	212, 226, 245
Hsp92II	CATG	8 cut(s)	225, 489, 532, 546, 588, 669, 744, 763
HspAI	GCGC	2 cut(s)	621, 653
Kzo9I	GATC	1 cut(s)	326
LmnI	GCTCC	2 cut(s)	37, 549
LpnPI	CCDG	9 cut(s)	20, 86, 122, 137, 139, 538, 607, 661, 690
Lsp1109I	GCAGC	3 cut(s)	135, 174, 691
LweI	GCATC	2 cut(s)	69, 199
MaeII	ACGT	3 cut(s)	212, 226, 245
MaeIII	GTNAC	2 cut(s)	640, 781
MalI	GATC	1 cut(s)	328
MbiI	CCGCTC	1 cut(s)	673
MboI	GATC	1 cut(s)	326
MboII	GAAGA	1 cut(s)	228
MhlI	GDGCHC	2 cut(s)	6, 366
MluCI	AATT	2 cut(s)	416, 429
MlyI	GAGTC	1 cut(s)	637
MnlI	CCTC	4 cut(s)	131, 133, 306, 419
MslI	CAYNNNNRTG	2 cut(s)	460, 533
MspI	CCGG	1 cut(s)	109
MwoI	GCNNNNNNNGC	3 cut(s)	187, 679, 756
NdeII	GATC	1 cut(s)	326
NlaIII	CATG	8 cut(s)	225, 489, 532, 546, 588, 669, 744, 763
NlaIV	GGNNCC	2 cut(s)	4, 5
NmuCI	GTSAC	1 cut(s)	640
NspI	RCATGY	2 cut(s)	744, 763
PaeI	GCATGC	1 cut(s)	763
PaeR7I	CTCGAG	1 cut(s)	365
PciI	ACATGT	1 cut(s)	740
PfeI	GAWTC	1 cut(s)	10
PkrI	GCNGC	3 cut(s)	150, 189, 681
PleI	GAGTC	1 cut(s)	637
PpsI	GAGTC	1 cut(s)	637
PpuMI	RGGWCCY	1 cut(s)	591
PscI	ACATGT	1 cut(s)	740
Psp5II	RGGWCCY	1 cut(s)	591
PspFI	CCCAGC	1 cut(s)	72
PspN4I	GGNNCC	2 cut(s)	4, 5
PspOMI	GGGCCC	1 cut(s)	2
PspPI	GGNCC	5 cut(s)	2, 3, 70, 482, 591
PspPPI	RGGWCCY	1 cut(s)	591
PspXI	VCTCGAGB	1 cut(s)	365
PstI	CTGCAG	1 cut(s)	706
RsaI	GTAC	4 cut(s)	405, 541, 598, 810
RsaNI	GTAC	4 cut(s)	404, 540, 597, 809
RseI	CAYNNNNRTG	2 cut(s)	460, 533
SatI	GCNGC	3 cut(s)	149, 188, 680
Sau3AI	GATC	1 cut(s)	326
Sau96I	GGNCC	5 cut(s)	2, 3, 70, 482, 591
SchI	GAGTC	1 cut(s)	637
SduI	GDGCHC	2 cut(s)	6, 366
SfaNI	GCATC	2 cut(s)	69, 199
SfcI	CTRYAG	2 cut(s)	330, 702
Sfr274I	CTCGAG	1 cut(s)	365
SinI	GGWCC	1 cut(s)	591
SlaI	CTCGAG	1 cut(s)	365
SmiMI	CAYNNNNRTG	2 cut(s)	460, 533
SmlI	CTYRAG	1 cut(s)	365
SmoI	CTYRAG	1 cut(s)	365
SphI	GCATGC	1 cut(s)	763
Sse9I	AATT	2 cut(s)	416, 429
SsiI	CCGC	3 cut(s)	378, 556, 671
StyI	CCWWGG	2 cut(s)	272, 305
TaaI	ACNGT	1 cut(s)	237
TaiI	ACGT	3 cut(s)	215, 229, 248
TaqI	TCGA	3 cut(s)	175, 366, 608
TasI	AATT	2 cut(s)	416, 429
TatI	WGTACW	3 cut(s)	539, 596, 808
TfiI	GAWTC	1 cut(s)	10
TscAI	CASTG	2 cut(s)	20, 158
TseFI	GTSAC	1 cut(s)	640
TseI	GCWGC	3 cut(s)	148, 187, 679
Tsp45I	GTSAC	1 cut(s)	640
TspDTI	ATGAA	2 cut(s)	434, 601
TspGWI	ACGGA	1 cut(s)	407
TspRI	CASTG	2 cut(s)	20, 158
VpaK11BI	GGWCC	1 cut(s)	591
XapI	RAATTY	1 cut(s)	429
XceI	RCATGY	2 cut(s)	744, 763
XcmI	CCANNNNNNNNNTGG	1 cut(s)	64
XhoI	CTCGAG	1 cut(s)	365

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.