Rmu_sc0005580.1_g000009

translation initiation factor activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005580.1
Physical Location & Seq
Forward (+)
70345 .. 70924
580 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005580.1_g000009.1.cds

Sequence Viewer

Length: 441 bp
atggaaatggggacaaattcagacccttcgataagcttgcacgccacgagacacaaaacgggtcagactaggttagagagaatagacgggtcttgcggtttttgggtttgtgggattgagatagaggaacaaggatttggggattgggacttaactctaaggtttggagtttttggattgaaggttgaagacgtgaaggctatgacgtttaagacagtagaagacgcggagaggttgtattctgcatattccttggcacttggctttggatttaggaaggataccaaaggagaggctgaaggtacgatccggaggagacaatggctttgcaacaagcaagggactcgagctaaaaagtggttcatactggacggaaggggtcgtactcctcggaaaattacaagggtaaattgcaaggctaagtttacaacgagcttgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

146

Amino Acids

16.62

Weight (kDa)

9.57

Isoelectric Point (pI)

35.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 227
AccIII TCCGGA 1 cut(s) 309
AciI CCGC 2 cut(s) 96, 227
AclWI GGATC 1 cut(s) 301
AcsI RAATTY 1 cut(s) 16
AcuI CTGAAG 1 cut(s) 318
AfaI GTAC 2 cut(s) 304, 385
AgsI TTSAA 2 cut(s) 181, 188
AjiI CACGTC 1 cut(s) 193
AjuI GAANNNNNNNTTGG 2 cut(s) 120, 152
AluBI AGCT 3 cut(s) 36, 350, 435
AluI AGCT 3 cut(s) 36, 350, 435
Alw26I GTCTC 2 cut(s) 43, 310
AlwI GGATC 1 cut(s) 301
Ama87I CYCGRG 1 cut(s) 345
Aor13HI TCCGGA 1 cut(s) 309
ApoI RAATTY 1 cut(s) 16
ArsI GACNNNNNNTTYG 2 cut(s) 309, 341
AvaI CYCGRG 1 cut(s) 345
BarI GAAGNNNNNNTAC 2 cut(s) 367, 399
BauI CACGAG 1 cut(s) 46
BbsI GAAGAC 2 cut(s) 195, 228
BcgI CGANNNNNNTGC 4 cut(s) 19, 53, 326, 360
BciVI GTATCC 1 cut(s) 274
BcoDI GTCTC 2 cut(s) 43, 310
BfaI CTAG 1 cut(s) 69
BfuI GTATCC 1 cut(s) 274
BmeT110I CYCGRG 1 cut(s) 345
BmgBI CACGTC 1 cut(s) 193
BpiI GAAGAC 2 cut(s) 195, 228
BsaJI CCNNGG 2 cut(s) 252, 389
BsaWI WCCGGW 1 cut(s) 309
BsaXI ACNNNNNCTCC 2 cut(s) 221, 251
Bse1I ACTGG 1 cut(s) 372
BseAI TCCGGA 1 cut(s) 309
BseDI CCNNGG 2 cut(s) 252, 389
BseNI ACTGG 1 cut(s) 372
BseRI GAGGAG 2 cut(s) 328, 378
Bsh1236I CGCG 1 cut(s) 227
BsiHKCI CYCGRG 1 cut(s) 345
BsiSI CCGG 1 cut(s) 310
BslFI GGGAC 3 cut(s) 25, 161, 355
BsmAI GTCTC 2 cut(s) 43, 310
BsmFI GGGAC 3 cut(s) 25, 161, 355
BsoBI CYCGRG 1 cut(s) 345
Bsp13I TCCGGA 1 cut(s) 309
Bsp143I GATC 1 cut(s) 306
BspACI CCGC 2 cut(s) 96, 227
BspEI TCCGGA 1 cut(s) 309
BspFNI CGCG 1 cut(s) 227
BspPI GGATC 1 cut(s) 301
BsrI ACTGG 1 cut(s) 372
BssECI CCNNGG 2 cut(s) 252, 389
BssMI GATC 1 cut(s) 306
BssSI CACGAG 1 cut(s) 46
BssT1I CCWWGG 1 cut(s) 252
Bst2BI CACGAG 1 cut(s) 46
Bst4CI ACNGT 1 cut(s) 217
BstC8I GCNNGC 2 cut(s) 38, 42
BstDEI CTNAG 2 cut(s) 158, 420
BstFNI CGCG 1 cut(s) 227
BstKTI GATC 1 cut(s) 309
BstMAI GTCTC 2 cut(s) 43, 310
BstMBI GATC 1 cut(s) 306
BstUI CGCG 1 cut(s) 227
BstV2I GAAGAC 2 cut(s) 195, 228
BsuI GTATCC 1 cut(s) 274
BtrI CACGTC 1 cut(s) 193
Cac8I GCNNGC 2 cut(s) 38, 42
CseI GACGC 1 cut(s) 233
Csp6I GTAC 2 cut(s) 303, 384
CviJI RGCY 8 cut(s) 36, 200, 264, 296, 325, 350, 419, 435
CviKI_1 RGCY 8 cut(s) 36, 200, 264, 296, 325, 350, 419, 435
CviQI GTAC 2 cut(s) 303, 384
DdeI CTNAG 2 cut(s) 158, 420
DpnI GATC 1 cut(s) 308
DpnII GATC 1 cut(s) 306
Eco130I CCWWGG 1 cut(s) 252
Eco57I CTGAAG 1 cut(s) 318
Eco88I CYCGRG 1 cut(s) 345
EcoT14I CCWWGG 1 cut(s) 252
ErhI CCWWGG 1 cut(s) 252
FaiI YATR 3 cut(s) 203, 247, 365
FaqI GGGAC 3 cut(s) 25, 161, 355
FspBI CTAG 1 cut(s) 69
HapII CCGG 1 cut(s) 310
HgaI GACGC 1 cut(s) 233
HindIII AAGCTT 1 cut(s) 34
HinfI GANTC 1 cut(s) 343
HpaII CCGG 1 cut(s) 310
Hpy166II GTNNAC 1 cut(s) 426
Hpy188I TCNGA 3 cut(s) 22, 66, 393
Hpy188III TCNNGA 1 cut(s) 310
Hpy8I GTNNAC 1 cut(s) 426
HpyAV CCTTC 6 cut(s) 36, 175, 190, 271, 293, 369
HpyCH4III ACNGT 1 cut(s) 217
HpyCH4IV ACGT 2 cut(s) 192, 206
HpyCH4V TGCA 4 cut(s) 40, 245, 330, 414
HpyF3I CTNAG 2 cut(s) 158, 420
HpySE526I ACGT 2 cut(s) 192, 206
Kpn2I TCCGGA 1 cut(s) 309
Kzo9I GATC 1 cut(s) 306
LpnPI CCDG 2 cut(s) 323, 353
MaeI CTAG 1 cut(s) 69
MaeII ACGT 2 cut(s) 192, 206
MalI GATC 1 cut(s) 308
MboI GATC 1 cut(s) 306
MboII GAAGA 2 cut(s) 200, 233
MluCI AATT 3 cut(s) 16, 396, 409
MlyI GAGTC 1 cut(s) 337
MnlI CCTC 5 cut(s) 118, 225, 286, 306, 399
MroI TCCGGA 1 cut(s) 309
MseI TTAA 2 cut(s) 152, 210
MspI CCGG 1 cut(s) 310
MvnI CGCG 1 cut(s) 227
NdeII GATC 1 cut(s) 306
PaeR7I CTCGAG 1 cut(s) 345
PleI GAGTC 1 cut(s) 337
PpsI GAGTC 1 cut(s) 337
PspXI VCTCGAGB 1 cut(s) 345
RsaI GTAC 2 cut(s) 304, 385
RsaNI GTAC 2 cut(s) 303, 384
SaqAI TTAA 2 cut(s) 152, 210
Sau3AI GATC 1 cut(s) 306
SchI GAGTC 1 cut(s) 337
Sfr274I CTCGAG 1 cut(s) 345
SlaI CTCGAG 1 cut(s) 345
SmlI CTYRAG 1 cut(s) 345
SmoI CTYRAG 1 cut(s) 345
Sse9I AATT 3 cut(s) 16, 396, 409
SsiI CCGC 2 cut(s) 96, 227
SspMI CTAG 1 cut(s) 69
StyI CCWWGG 1 cut(s) 252
TaaI ACNGT 1 cut(s) 217
TaiI ACGT 2 cut(s) 195, 209
TaqI TCGA 2 cut(s) 29, 346
TasI AATT 3 cut(s) 16, 396, 409
Tru1I TTAA 2 cut(s) 152, 210
Tru9I TTAA 2 cut(s) 152, 210
TspDTI ATGAA 1 cut(s) 352
TspGWI ACGGA 1 cut(s) 387
XapI RAATTY 1 cut(s) 16
XhoI CTCGAG 1 cut(s) 345
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.