Rh2CG318700

protein FAR1-RELATED SEQUENCE

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
40756731 .. 40757042
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG318700.1

Sequence Viewer

Length: 312 bp
ATGAGTTCGTTTGTGAGAACAGGTTATTTAATAAAAGATGACATGAACTCAGAGCATGCTAGTTCCAGAGACGGAAGATTGAACATGGAGGAATCACTGGTCCAGGAGACGGGGGAGCTGGATGAGGAAGTTGATGATAGTAACAGTAATATAAATGCCACAACAGAGTGTGTGAGTCCGAGTTCTTTACCTGAAGGGGAAAATTTCAAGGAATTGACTGCTGATGACGTAGTAGGAAGACAGTTTCCAACTGTGGAGGATGCTGAAAGATGGTATAGAATGTATGGAACTGCCATTGGTTTTGGTGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.45

Weight (kDa)

4.14

Isoelectric Point (pI)

51.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 202
AcuI CTGAAG 1 cut(s) 213
AfiI CCNNNNNNNGG 1 cut(s) 109
AgsI TTSAA 2 cut(s) 82, 208
AjnI CCWGG 1 cut(s) 102
AluBI AGCT 1 cut(s) 118
AluI AGCT 1 cut(s) 118
Alw26I GTCTC 2 cut(s) 63, 101
ApoI RAATTY 1 cut(s) 202
AspS9I GGNCC 1 cut(s) 100
AvaII GGWCC 1 cut(s) 100
BbsI GAAGAC 1 cut(s) 244
BccI CCATC 1 cut(s) 264
BciT130I CCWGG 1 cut(s) 104
BcoDI GTCTC 2 cut(s) 63, 101
BfaI CTAG 1 cut(s) 60
Bme1390I CCNGG 1 cut(s) 104
Bme18I GGWCC 1 cut(s) 100
BmgT120I GGNCC 1 cut(s) 100
BmrFI CCNGG 1 cut(s) 104
BmsI GCATC 1 cut(s) 250
BpiI GAAGAC 1 cut(s) 244
Bsc4I CCNNNNNNNGG 1 cut(s) 109
Bse1I ACTGG 1 cut(s) 102
BseBI CCWGG 1 cut(s) 104
BseGI GGATG 2 cut(s) 127, 265
BseLI CCNNNNNNNGG 1 cut(s) 109
BseMII CTCAG 1 cut(s) 63
BseNI ACTGG 1 cut(s) 102
BslI CCNNNNNNNGG 1 cut(s) 109
BsmAI GTCTC 2 cut(s) 63, 101
BsmBI CGTCTC 2 cut(s) 63, 101
BspCNI CTCAG 1 cut(s) 62
BsrI ACTGG 1 cut(s) 102
Bst2UI CCWGG 1 cut(s) 104
Bst4CI ACNGT 3 cut(s) 146, 243, 253
BstC8I GCNNGC 1 cut(s) 57
BstDEI CTNAG 1 cut(s) 49
BstF5I GGATG 2 cut(s) 127, 265
BstMAI GTCTC 2 cut(s) 63, 101
BstNI CCWGG 1 cut(s) 104
BstNSI RCATGY 1 cut(s) 59
BstSCI CCNGG 1 cut(s) 102
BstV2I GAAGAC 1 cut(s) 244
BtsCI GGATG 2 cut(s) 127, 265
BtsIMutI CAGTG 1 cut(s) 95
Cac8I GCNNGC 1 cut(s) 57
Cfr13I GGNCC 1 cut(s) 100
CviAII CATG 4 cut(s) 43, 56, 85, 309
CviJI RGCY 1 cut(s) 118
CviKI_1 RGCY 1 cut(s) 118
DdeI CTNAG 1 cut(s) 49
Eco47I GGWCC 1 cut(s) 100
Eco57I CTGAAG 1 cut(s) 213
EcoRII CCWGG 1 cut(s) 102
Esp3I CGTCTC 2 cut(s) 63, 101
FaeI CATG 4 cut(s) 46, 59, 88, 312
FaiI YATR 7 cut(s) 44, 57, 86, 152, 276, 285, 310
FatI CATG 4 cut(s) 42, 55, 84, 308
FokI GGATG 2 cut(s) 134, 272
FspBI CTAG 1 cut(s) 60
Hin1II CATG 4 cut(s) 46, 59, 88, 312
HinfI GANTC 2 cut(s) 92, 175
Hpy188I TCNGA 2 cut(s) 52, 180
Hpy188III TCNNGA 1 cut(s) 66
HpyAV CCTTC 1 cut(s) 188
HpyCH4III ACNGT 3 cut(s) 146, 243, 253
HpyCH4IV ACGT 1 cut(s) 228
HpyCH4V TGCA 1 cut(s) 308
HpyF3I CTNAG 1 cut(s) 49
HpySE526I ACGT 1 cut(s) 228
Hsp92II CATG 4 cut(s) 46, 59, 88, 312
LmnI GCTCC 1 cut(s) 115
LpnPI CCDG 7 cut(s) 6, 79, 83, 89, 104, 116, 204
LweI GCATC 1 cut(s) 250
MaeI CTAG 1 cut(s) 60
MaeII ACGT 1 cut(s) 228
MaeIII GTNAC 1 cut(s) 140
MboII GAAGA 2 cut(s) 87, 249
MluCI AATT 2 cut(s) 202, 212
MlyI GAGTC 1 cut(s) 184
MmeI TCCRAC 1 cut(s) 272
MnlI CCTC 3 cut(s) 82, 118, 250
MseI TTAA 1 cut(s) 29
MspR9I CCNGG 1 cut(s) 104
MvaI CCWGG 1 cut(s) 104
NlaIII CATG 4 cut(s) 46, 59, 88, 312
NspI RCATGY 1 cut(s) 59
PaeI GCATGC 1 cut(s) 59
PfeI GAWTC 1 cut(s) 92
PfoI TCCNGGA 1 cut(s) 102
PleI GAGTC 1 cut(s) 183
PpsI GAGTC 1 cut(s) 183
Psp6I CCWGG 1 cut(s) 102
PspGI CCWGG 1 cut(s) 102
PspPI GGNCC 1 cut(s) 100
SaqAI TTAA 1 cut(s) 29
Sau96I GGNCC 1 cut(s) 100
SchI GAGTC 1 cut(s) 184
ScrFI CCNGG 1 cut(s) 104
SetI ASST 4 cut(s) 25, 120, 193, 231
SfaNI GCATC 1 cut(s) 250
SinI GGWCC 1 cut(s) 100
SphI GCATGC 1 cut(s) 59
Sse9I AATT 2 cut(s) 202, 212
SspMI CTAG 1 cut(s) 60
StyD4I CCNGG 1 cut(s) 102
TaaI ACNGT 3 cut(s) 146, 243, 253
TaiI ACGT 1 cut(s) 231
TasI AATT 2 cut(s) 202, 212
TfiI GAWTC 1 cut(s) 92
Tru1I TTAA 1 cut(s) 29
Tru9I TTAA 1 cut(s) 29
TscAI CASTG 1 cut(s) 102
TspDTI ATGAA 1 cut(s) 59
TspGWI ACGGA 1 cut(s) 87
TspRI CASTG 1 cut(s) 102
VpaK11BI GGWCC 1 cut(s) 100
XapI RAATTY 1 cut(s) 202
XceI RCATGY 1 cut(s) 59
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.