pycom10g02510

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Reverse (-)
2879289 .. 2879935
647 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 474 bp
ATGCTCCAACAACCTGGCTTCTGGACTCCGGAGCCAACACTCACATTACTAATGATCCTGGCCAACTTACCAATGCATATGAGTACACATGCACATATCAAGTTAATAGTGGTCAAGGATATCCGCTTGGGGAGGACCCTTTTATCAGGCCGGAGTAACATTGGTGTTTATCATTATGCAAGTTTTAATTCAAATAAAAGACATGAACTGTTTTCATGCATAGGAGTTAGGGTCGATGATCGCATTTGGCACTCCAAACTTGGTCATCCATCATCATTTATTTTAAAACATTTAGTTTCCAGTAGTAAAGTGCCTCTTACTAGGCACCATTTCAATTCTATATGTCATTCATACCCTTTGGGCAAAAGTAAGAAATTGCCATTTTTACCATCAAATTCCATTTCTCATTTTCCTTTACAACTTATTCATTATGATGTATGGACGTCACCAACTCTGTCAATTTCTGGTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

158

Amino Acids

17.86

Weight (kDa)

10.08

Isoelectric Point (pI)

64.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
gag_pre-integrs PF13976 71 - 123 1.4e-08 GAG-pre-integrase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 446
AccB1I GGYRCC 1 cut(s) 324
AccIII TCCGGA 1 cut(s) 28
AciI CCGC 1 cut(s) 124
AclWI GGATC 1 cut(s) 49
AcoI YGGCCR 1 cut(s) 60
AcsI RAATTY 1 cut(s) 394
AcyI GRCGYC 1 cut(s) 443
AfaI GTAC 1 cut(s) 85
AgsI TTSAA 2 cut(s) 192, 334
AjnI CCWGG 2 cut(s) 13, 57
AlwI GGATC 1 cut(s) 49
Aor13HI TCCGGA 1 cut(s) 28
AoxI GGCC 2 cut(s) 60, 148
ApoI RAATTY 1 cut(s) 394
AspS9I GGNCC 1 cut(s) 135
AsuHPI GGTGA 1 cut(s) 438
AvaII GGWCC 1 cut(s) 135
BalI TGGCCA 1 cut(s) 62
BanI GGYRCC 1 cut(s) 324
BccI CCATC 2 cut(s) 277, 397
BciT130I CCWGG 2 cut(s) 15, 59
BfaI CTAG 1 cut(s) 321
Bme1390I CCNGG 2 cut(s) 15, 59
Bme18I GGWCC 1 cut(s) 135
BmgT120I GGNCC 1 cut(s) 135
BmiI GGNNCC 3 cut(s) 33, 137, 326
BmrFI CCNGG 2 cut(s) 15, 59
BsaHI GRCGYC 1 cut(s) 443
BsaWI WCCGGW 1 cut(s) 28
BsaXI ACNNNNNCTCC 2 cut(s) 216, 246
Bse1I ACTGG 1 cut(s) 300
BseAI TCCGGA 1 cut(s) 28
BseBI CCWGG 2 cut(s) 15, 59
BseGI GGATG 1 cut(s) 265
BseNI ACTGG 1 cut(s) 300
BshFI GGCC 2 cut(s) 62, 150
BshNI GGYRCC 1 cut(s) 324
BsiSI CCGG 2 cut(s) 29, 151
BsnI GGCC 2 cut(s) 62, 150
Bsp13I TCCGGA 1 cut(s) 28
Bsp143I GATC 2 cut(s) 54, 238
BspACI CCGC 1 cut(s) 124
BspANI GGCC 2 cut(s) 62, 150
BspEI TCCGGA 1 cut(s) 28
BspLI GGNNCC 3 cut(s) 33, 137, 326
BspPI GGATC 1 cut(s) 49
BspT107I GGYRCC 1 cut(s) 324
BsrI ACTGG 1 cut(s) 300
BssMI GATC 2 cut(s) 54, 238
BssNI GRCGYC 1 cut(s) 443
Bst2UI CCWGG 2 cut(s) 15, 59
Bst4CI ACNGT 1 cut(s) 210
BstACI GRCGYC 1 cut(s) 443
BstF5I GGATG 1 cut(s) 265
BstKTI GATC 2 cut(s) 57, 241
BstMBI GATC 2 cut(s) 54, 238
BstNI CCWGG 2 cut(s) 15, 59
BstNSI RCATGY 1 cut(s) 92
BstSCI CCNGG 2 cut(s) 13, 57
BstXI CCANNNNNNTGG 1 cut(s) 14
BsuRI GGCC 2 cut(s) 62, 150
BtsCI GGATG 1 cut(s) 265
Cfr13I GGNCC 1 cut(s) 135
Csp6I GTAC 1 cut(s) 84
CviAII CATG 3 cut(s) 89, 203, 216
CviJI RGCY 4 cut(s) 18, 34, 62, 150
CviKI_1 RGCY 4 cut(s) 18, 34, 62, 150
CviQI GTAC 1 cut(s) 84
DpnI GATC 2 cut(s) 56, 240
DpnII GATC 2 cut(s) 54, 238
DraI TTTAAA 1 cut(s) 285
EaeI YGGCCR 1 cut(s) 60
Eco32I GATATC 1 cut(s) 121
Eco47I GGWCC 1 cut(s) 135
EcoO109I RGGNCCY 1 cut(s) 135
EcoRII CCWGG 2 cut(s) 13, 57
EcoRV GATATC 1 cut(s) 121
EcoT22I ATGCAT 2 cut(s) 78, 221
FaeI CATG 3 cut(s) 92, 206, 219
FalI AAGNNNNNCTT 2 cut(s) 300, 332
FatI CATG 3 cut(s) 88, 202, 215
FauNDI CATATG 1 cut(s) 78
FokI GGATG 1 cut(s) 252
FspBI CTAG 1 cut(s) 321
HaeIII GGCC 2 cut(s) 62, 150
HapII CCGG 2 cut(s) 29, 151
Hin1I GRCGYC 1 cut(s) 443
Hin1II CATG 3 cut(s) 92, 206, 219
HinfI GANTC 1 cut(s) 25
HpaII CCGG 2 cut(s) 29, 151
HphI GGTGA 1 cut(s) 438
Hpy166II GTNNAC 1 cut(s) 86
Hpy188III TCNNGA 2 cut(s) 22, 29
Hpy8I GTNNAC 1 cut(s) 86
HpyCH4III ACNGT 1 cut(s) 210
HpyCH4IV ACGT 1 cut(s) 443
HpyCH4V TGCA 4 cut(s) 76, 92, 179, 219
HpySE526I ACGT 1 cut(s) 443
Hsp92I GRCGYC 1 cut(s) 443
Hsp92II CATG 3 cut(s) 92, 206, 219
Kpn2I TCCGGA 1 cut(s) 28
Kzo9I GATC 2 cut(s) 54, 238
LmnI GCTCC 2 cut(s) 9, 31
LpnPI CCDG 9 cut(s) 7, 27, 42, 44, 71, 132, 164, 313, 450
MaeI CTAG 1 cut(s) 321
MaeII ACGT 1 cut(s) 443
MaeIII GTNAC 2 cut(s) 155, 444
MalI GATC 2 cut(s) 56, 240
MboI GATC 2 cut(s) 54, 238
MlsI TGGCCA 1 cut(s) 62
MluCI AATT 5 cut(s) 187, 334, 374, 394, 459
MluNI TGGCCA 1 cut(s) 62
MlyI GAGTC 1 cut(s) 19
MmeI TCCRAC 1 cut(s) 31
MnlI CCTC 2 cut(s) 126, 324
Mox20I TGGCCA 1 cut(s) 62
Mph1103I ATGCAT 2 cut(s) 78, 221
MroI TCCGGA 1 cut(s) 28
MscI TGGCCA 1 cut(s) 62
MseI TTAA 3 cut(s) 104, 186, 284
MslI CAYNNNNRTG 1 cut(s) 432
Msp20I TGGCCA 1 cut(s) 62
MspI CCGG 2 cut(s) 29, 151
MspR9I CCNGG 2 cut(s) 15, 59
MvaI CCWGG 2 cut(s) 15, 59
NdeI CATATG 1 cut(s) 78
NdeII GATC 2 cut(s) 54, 238
NlaIII CATG 3 cut(s) 92, 206, 219
NlaIV GGNNCC 3 cut(s) 33, 137, 326
NmuCI GTSAC 1 cut(s) 444
NsiI ATGCAT 2 cut(s) 78, 221
NspI RCATGY 1 cut(s) 92
PleI GAGTC 1 cut(s) 19
PpsI GAGTC 1 cut(s) 19
PpuMI RGGWCCY 1 cut(s) 135
Psp5II RGGWCCY 1 cut(s) 135
Psp6I CCWGG 2 cut(s) 13, 57
PspGI CCWGG 2 cut(s) 13, 57
PspN4I GGNNCC 3 cut(s) 33, 137, 326
PspPI GGNCC 1 cut(s) 135
PspPPI RGGWCCY 1 cut(s) 135
RsaI GTAC 1 cut(s) 85
RsaNI GTAC 1 cut(s) 84
RseI CAYNNNNRTG 1 cut(s) 432
SaqAI TTAA 3 cut(s) 104, 186, 284
Sau3AI GATC 2 cut(s) 54, 238
Sau96I GGNCC 1 cut(s) 135
SchI GAGTC 1 cut(s) 19
ScrFI CCNGG 2 cut(s) 15, 59
SetI ASST 2 cut(s) 16, 446
SinI GGWCC 1 cut(s) 135
SmiMI CAYNNNNRTG 1 cut(s) 432
Sse9I AATT 5 cut(s) 187, 334, 374, 394, 459
SsiI CCGC 1 cut(s) 124
SspMI CTAG 1 cut(s) 321
StyD4I CCNGG 2 cut(s) 13, 57
TaaI ACNGT 1 cut(s) 210
TaiI ACGT 1 cut(s) 446
TaqI TCGA 1 cut(s) 234
TasI AATT 5 cut(s) 187, 334, 374, 394, 459
TatI WGTACW 1 cut(s) 83
Tru1I TTAA 3 cut(s) 104, 186, 284
Tru9I TTAA 3 cut(s) 104, 186, 284
TseFI GTSAC 1 cut(s) 444
Tsp45I GTSAC 1 cut(s) 444
TspDTI ATGAA 4 cut(s) 204, 219, 339, 416
VpaK11BI GGWCC 1 cut(s) 135
XapI RAATTY 1 cut(s) 394
XceI RCATGY 1 cut(s) 92
XspI CTAG 1 cut(s) 321
ZraI GACGTC 1 cut(s) 444
Zsp2I ATGCAT 2 cut(s) 78, 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.