Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr15

Orthogroup ID

OG0000901

Physical Location & Seq

Genomic Coordinates Forward (+)

7172427 .. 7173302

Gene Structure 876 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom15g10740.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 564 bp

ATGAGAATGAGCTTGCCAACATGGTGGCCACTGCAGCCCACATCGATCGATCATCCAGTTTGCTTCCGATATCCAAGGGGCGCCATTGTTGGGATGGACCATTCCGTATGCAGTGGAACCCCCATTGAGATTGGAAAAGGGAAAATTCTTGCGGAGGGGAAAGATGTGGCATTGCTTGGATACGGATCAATGGTTCAGAACTGCCTTAAGGCTCGGTCTCTTCTTTCAACGCTGGGCATTGATGTAACAGTTGCTGATGCAAGGTTCTGCAAGCCCTTAGATGTCAAGCTTCTTAGGCAGCTTTGTCGGAACCATTCATATCTGATCACGGTTGAGGAAGGATCTATTGGAGGATTTGGATCCCATGTTGCACAGTTCATTTGTCTCGACGGACAGCTTGATGGAAACATCAAGTGGCGACCAATTGTTTTACCGGACAACTACATTGAGCATGCATCCCCAAATGAGCAGCTAGCTATTGCTGGACTAACTGGACACCACATAGCAGCAACGGTGTTAACTCTGCTTGGCCGAACTCGTGAAGCCCTTCACTTAATGTGCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00730 ko00900 ko01100 ko01110 ko01130 map00730 map00900 map01100 map01110 map01130

Pfam Domains

Protein Families

DXP_synthase_N Transket_pyr Transketolase_C

Protein Analysis

188

Amino Acids

20.41

Weight (kDa)

7.66

Isoelectric Point (pI)

30.6

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Transketolase_C	PF02780	45 - 168	1.2e-31	Transketolase, C-terminal domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000901)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G21500 AT3G21500 AT3G21500 AT4G15560
fragaria_vesca	FvH4_1g19340 FvH4_1g19340 FvH4_1g19340 FvH4_1g19340 FvH4_4g16950 FvH4_4g16950 FvH4_4g16950
malus_domestica	MD01G1041300.v1.1 MD13G1175400.v1.1 MD15G1309900.v1.1 MD16G1177200.v1.1
prunus_persica	Prupe.1G144100_v2.0.a1 Prupe.1G144100_v2.0.a1 Prupe.1G144100_v2.0.a1 Prupe.1G472400_v2.0.a1 Prupe.1G472400_v2.0.a1 Prupe.6G204700_v2.0.a1
pyrus_communis	pycom01g06900 pycom01g06910 pycom04g12340 pycom13g15130 pycom15g10740 pycom15g27390 pycom16g14880
rosa_chinensis	RchiOBHm_Chr2g0110711 RchiOBHm_Chr4g0403671 RchiOBHm_Chr4g0403701 RchiOBHm_Chr4g0420531
rosa_laevigata	RLG00000007753 RLG00000008956 RLG00000008960 RLG00000017835
rosa_multiflora	Rmu_co8068784.1_g000001 Rmu_sc0000389.1_g000047 Rmu_sc0001496.1_g000014 Rmu_sc0002248.1_g000052 Rmu_sc0004115.1_g000015
rosa_roxburghii	Rroxscaffold_2G00133000 Rroxscaffold_5G00348270 Rroxscaffold_5G00348360 Rroxscaffold_5G00363150
rosa_rugosa	Rorug02G0169200 Rorug04G0045300 Rorug04G0164800
rosa_samantha	Rh2BG231400 Rh2CG223700 Rh2DG227600 Rh4AG120600 Rh4AG120700 Rh4BG113400 Rh4BG113500 Rh4BG113700 Rh4BG113800 Rh4BG229100 Rh4CG129000 Rh4DG112700 Rh4DG113600
rosa_wichuraiana	Rw2G017080 Rw4G009750 Rw4G009820 Rw4G019540

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	80
AciI	CCGC	1 cut(s)	152
AclWI	GGATC	4 cut(s)	193, 349, 354, 367
AcoI	YGGCCR	2 cut(s)	26, 529
AcsI	RAATTY	1 cut(s)	144
AcyI	GRCGYC	1 cut(s)	81
AfiI	CCNNNNNNNGG	1 cut(s)	90
AflII	CTTAAG	1 cut(s)	206
AgsI	TTSAA	1 cut(s)	228
AjuI	GAANNNNNNNTTGG	2 cut(s)	330, 362
AloI	GAACNNNNNNTCC	2 cut(s)	177, 209
AluBI	AGCT	6 cut(s)	12, 289, 301, 397, 472, 476
AluI	AGCT	6 cut(s)	12, 289, 301, 397, 472, 476
Alw26I	GTCTC	2 cut(s)	222, 389
AlwI	GGATC	4 cut(s)	193, 349, 354, 367
AlwNI	CAGNNNCTG	1 cut(s)	254
AoxI	GGCC	2 cut(s)	26, 529
ApeKI	GCWGC	4 cut(s)	34, 298, 469, 506
ApoI	RAATTY	1 cut(s)	144
Asp700I	GAANNNNTTC	1 cut(s)	546
AspLEI	GCGC	1 cut(s)	83
AspS9I	GGNCC	1 cut(s)	97
AsuNHI	GCTAGC	1 cut(s)	472
AvaII	GGWCC	1 cut(s)	97
BalI	TGGCCA	1 cut(s)	28
BamHI	GGATCC	1 cut(s)	359
BanI	GGYRCC	1 cut(s)	80
BauI	CACGAG	1 cut(s)	537
BbvI	GCAGC	4 cut(s)	46, 310, 481, 518
BccI	CCATC	2 cut(s)	88, 395
BcgI	CGANNNNNNTGC	2 cut(s)	287, 321
BciVI	GTATCC	1 cut(s)	173
BclI	TGATCA	1 cut(s)	324
BcoDI	GTCTC	2 cut(s)	222, 389
BfaI	CTAG	2 cut(s)	473, 562
BfmI	CTRYAG	1 cut(s)	32
BfoI	RGCGCY	1 cut(s)	84
BfrI	CTTAAG	1 cut(s)	206
BfuI	GTATCC	1 cut(s)	173
BisI	GCNGC	4 cut(s)	35, 299, 470, 507
BlsI	GCNGC	4 cut(s)	36, 300, 471, 508
Bme18I	GGWCC	1 cut(s)	97
BmgT120I	GGNCC	1 cut(s)	97
BmiI	GGNNCC	4 cut(s)	82, 118, 311, 361
BmsI	GCATC	2 cut(s)	247, 464
BmtI	GCTAGC	1 cut(s)	476
Bsa29I	ATCGAT	2 cut(s)	44, 48
BsaBI	GATNNNNATC	2 cut(s)	184, 358
BsaHI	GRCGYC	1 cut(s)	81
BsaI	GGTCTC	1 cut(s)	222
BsaJI	CCNNGG	1 cut(s)	74
BsaWI	WCCGGW	1 cut(s)	433
Bsc4I	CCNNNNNNNGG	1 cut(s)	90
Bse1I	ACTGG	2 cut(s)	56, 496
Bse3DI	GCAATG	1 cut(s)	170
Bse8I	GATNNNNATC	2 cut(s)	184, 358
BseCI	ATCGAT	2 cut(s)	44, 48
BseDI	CCNNGG	1 cut(s)	74
BseGI	GGATG	3 cut(s)	52, 99, 455
BseJI	GATNNNNATC	2 cut(s)	184, 358
BseLI	CCNNNNNNNGG	1 cut(s)	90
BseMI	GCAATG	1 cut(s)	170
BseNI	ACTGG	2 cut(s)	56, 496
BseXI	GCAGC	4 cut(s)	46, 310, 481, 518
BseYI	CCCAGC	1 cut(s)	232
Bsh1285I	CGRYCG	1 cut(s)	48
BshFI	GGCC	2 cut(s)	28, 531
BshNI	GGYRCC	1 cut(s)	80
BshVI	ATCGAT	2 cut(s)	44, 48
BsiEI	CGRYCG	1 cut(s)	48
BsiSI	CCGG	1 cut(s)	434
BslI	CCNNNNNNNGG	1 cut(s)	90
BsmAI	GTCTC	2 cut(s)	222, 389
BsnI	GGCC	2 cut(s)	28, 531
Bso31I	GGTCTC	1 cut(s)	222
Bsp143I	GATC	6 cut(s)	45, 49, 185, 324, 341, 359
BspACI	CCGC	1 cut(s)	152
BspANI	GGCC	2 cut(s)	28, 531
BspDI	ATCGAT	2 cut(s)	44, 48
BspLI	GGNNCC	4 cut(s)	82, 118, 311, 361
BspMAI	CTGCAG	1 cut(s)	36
BspOI	GCTAGC	1 cut(s)	476
BspPI	GGATC	4 cut(s)	193, 349, 354, 367
BspT107I	GGYRCC	1 cut(s)	80
BspTI	CTTAAG	1 cut(s)	206
BspTNI	GGTCTC	1 cut(s)	222
BsrDI	GCAATG	1 cut(s)	170
BsrI	ACTGG	2 cut(s)	56, 496
BssECI	CCNNGG	1 cut(s)	74
BssMI	GATC	6 cut(s)	45, 49, 185, 324, 341, 359
BssNI	GRCGYC	1 cut(s)	81
BssSI	CACGAG	1 cut(s)	537
BssT1I	CCWWGG	1 cut(s)	74
Bst2BI	CACGAG	1 cut(s)	537
Bst4CI	ACNGT	4 cut(s)	250, 331, 375, 514
Bst6I	CTCTTC	1 cut(s)	225
BstACI	GRCGYC	1 cut(s)	81
BstAFI	CTTAAG	1 cut(s)	206
BstC8I	GCNNGC	4 cut(s)	14, 272, 453, 474
BstDEI	CTNAG	2 cut(s)	277, 293
BstF5I	GGATG	3 cut(s)	52, 99, 455
BstH2I	RGCGCY	1 cut(s)	84
BstHHI	GCGC	1 cut(s)	83
BstKTI	GATC	6 cut(s)	48, 52, 188, 327, 344, 362
BstMAI	GTCTC	2 cut(s)	222, 389
BstMBI	GATC	6 cut(s)	45, 49, 185, 324, 341, 359
BstMCI	CGRYCG	1 cut(s)	48
BstMWI	GCNNNNNNNGC	2 cut(s)	34, 295
BstNSI	RCATGY	1 cut(s)	455
BstSFI	CTRYAG	1 cut(s)	32
BstV1I	GCAGC	4 cut(s)	46, 310, 481, 518
BstX2I	RGATCY	2 cut(s)	341, 359
BstXI	CCANNNNNNTGG	1 cut(s)	24
BstYI	RGATCY	2 cut(s)	341, 359
Bsu15I	ATCGAT	2 cut(s)	44, 48
BsuI	GTATCC	1 cut(s)	173
BsuRI	GGCC	2 cut(s)	28, 531
BsuTUI	ATCGAT	2 cut(s)	44, 48
BtsCI	GGATG	3 cut(s)	52, 99, 455
BtsI	GCAGTG	2 cut(s)	29, 118
BtsIMutI	CAGTG	2 cut(s)	29, 118
Cac8I	GCNNGC	4 cut(s)	14, 272, 453, 474
CaiI	CAGNNNCTG	1 cut(s)	254
CfoI	GCGC	1 cut(s)	83
Cfr13I	GGNCC	1 cut(s)	97
ClaI	ATCGAT	2 cut(s)	44, 48
CviAII	CATG	3 cut(s)	21, 365, 452
DdeI	CTNAG	2 cut(s)	277, 293
DinI	GGCGCC	1 cut(s)	82
DpnI	GATC	6 cut(s)	47, 51, 187, 326, 343, 361
DpnII	GATC	6 cut(s)	45, 49, 185, 324, 341, 359
EaeI	YGGCCR	2 cut(s)	26, 529
Eam1104I	CTCTTC	1 cut(s)	225
EarI	CTCTTC	1 cut(s)	225
Eco130I	CCWWGG	1 cut(s)	74
Eco31I	GGTCTC	1 cut(s)	222
Eco32I	GATATC	1 cut(s)	71
Eco47I	GGWCC	1 cut(s)	97
EcoRV	GATATC	1 cut(s)	71
EcoT14I	CCWWGG	1 cut(s)	74
EcoT22I	ATGCAT	1 cut(s)	457
EgeI	GGCGCC	1 cut(s)	82
EheI	GGCGCC	1 cut(s)	82
ErhI	CCWWGG	1 cut(s)	74
FaeI	CATG	3 cut(s)	24, 368, 455
FaiI	YATR	6 cut(s)	22, 109, 319, 366, 453, 503
FatI	CATG	3 cut(s)	20, 364, 451
FbaI	TGATCA	1 cut(s)	324
Fnu4HI	GCNGC	4 cut(s)	35, 299, 470, 507
FokI	GGATG	3 cut(s)	39, 106, 442
Fsp4HI	GCNGC	4 cut(s)	35, 299, 470, 507
FspBI	CTAG	2 cut(s)	473, 562
GlaI	GCGC	1 cut(s)	82
GluI	GCNGC	4 cut(s)	35, 299, 470, 507
GsaI	CCCAGC	1 cut(s)	236
HaeII	RGCGCY	1 cut(s)	84
HaeIII	GGCC	2 cut(s)	28, 531
HapII	CCGG	1 cut(s)	434
HhaI	GCGC	1 cut(s)	83
Hin1I	GRCGYC	1 cut(s)	81
Hin1II	CATG	3 cut(s)	24, 368, 455
Hin6I	GCGC	1 cut(s)	81
HinP1I	GCGC	1 cut(s)	81
HincII	GTYRAC	1 cut(s)	519
HindII	GTYRAC	1 cut(s)	519
HindIII	AAGCTT	1 cut(s)	287
HpaI	GTTAAC	1 cut(s)	519
HpaII	CCGG	1 cut(s)	434
Hpy166II	GTNNAC	1 cut(s)	519
Hpy188I	TCNGA	4 cut(s)	68, 198, 309, 324
Hpy188III	TCNNGA	2 cut(s)	386, 539
Hpy8I	GTNNAC	1 cut(s)	519
Hpy99I	CGWCG	1 cut(s)	392
HpyAV	CCTTC	2 cut(s)	332, 557
HpyCH4III	ACNGT	4 cut(s)	250, 331, 375, 514
HpyCH4V	TGCA	6 cut(s)	34, 111, 260, 270, 371, 455
HpyF10VI	GCNNNNNNNGC	2 cut(s)	34, 295
HpyF3I	CTNAG	2 cut(s)	277, 293
Hsp92I	GRCGYC	1 cut(s)	81
Hsp92II	CATG	3 cut(s)	24, 368, 455
HspAI	GCGC	1 cut(s)	81
KasI	GGCGCC	1 cut(s)	80
Ksp22I	TGATCA	1 cut(s)	324
KspAI	GTTAAC	1 cut(s)	519
Kzo9I	GATC	6 cut(s)	45, 49, 185, 324, 341, 359
LpnPI	CCDG	5 cut(s)	69, 218, 447, 468, 477
Lsp1109I	GCAGC	4 cut(s)	46, 310, 481, 518
LweI	GCATC	2 cut(s)	247, 464
MaeI	CTAG	2 cut(s)	473, 562
MaeIII	GTNAC	1 cut(s)	244
MalI	GATC	6 cut(s)	47, 51, 187, 326, 343, 361
MboI	GATC	6 cut(s)	45, 49, 185, 324, 341, 359
MboII	GAAGA	1 cut(s)	212
MfeI	CAATTG	1 cut(s)	423
MflI	RGATCY	2 cut(s)	341, 359
MlsI	TGGCCA	1 cut(s)	28
MluCI	AATT	2 cut(s)	144, 423
MluNI	TGGCCA	1 cut(s)	28
Mly113I	GGCGCC	1 cut(s)	81
MmeI	TCCRAC	1 cut(s)	287
MnlI	CCTC	3 cut(s)	148, 328, 344
Mox20I	TGGCCA	1 cut(s)	28
Mph1103I	ATGCAT	1 cut(s)	457
MroXI	GAANNNNTTC	1 cut(s)	546
MscI	TGGCCA	1 cut(s)	28
MseI	TTAA	3 cut(s)	207, 518, 554
Msp20I	TGGCCA	1 cut(s)	28
MspCI	CTTAAG	1 cut(s)	206
MspI	CCGG	1 cut(s)	434
MunI	CAATTG	1 cut(s)	423
MwoI	GCNNNNNNNGC	2 cut(s)	34, 295
NarI	GGCGCC	1 cut(s)	81
NdeII	GATC	6 cut(s)	45, 49, 185, 324, 341, 359
NheI	GCTAGC	1 cut(s)	472
NlaIII	CATG	3 cut(s)	24, 368, 455
NlaIV	GGNNCC	4 cut(s)	82, 118, 311, 361
NsiI	ATGCAT	1 cut(s)	457
NspI	RCATGY	1 cut(s)	455
PaeI	GCATGC	1 cut(s)	455
PdmI	GAANNNNTTC	1 cut(s)	546
PkrI	GCNGC	4 cut(s)	36, 300, 471, 508
Ple19I	CGATCG	1 cut(s)	48
PluTI	GGCGCC	1 cut(s)	84
PspFI	CCCAGC	1 cut(s)	232
PspN4I	GGNNCC	4 cut(s)	82, 118, 311, 361
PspPI	GGNCC	1 cut(s)	97
PstI	CTGCAG	1 cut(s)	36
PstNI	CAGNNNCTG	1 cut(s)	254
PsuI	RGATCY	2 cut(s)	341, 359
PvuI	CGATCG	1 cut(s)	48
SaqAI	TTAA	3 cut(s)	207, 518, 554
SatI	GCNGC	4 cut(s)	35, 299, 470, 507
Sau3AI	GATC	6 cut(s)	45, 49, 185, 324, 341, 359
Sau96I	GGNCC	1 cut(s)	97
SetI	ASST	7 cut(s)	14, 266, 291, 303, 399, 474, 478
SfaNI	GCATC	2 cut(s)	247, 464
SfcI	CTRYAG	1 cut(s)	32
SfoI	GGCGCC	1 cut(s)	82
SinI	GGWCC	1 cut(s)	97
SmlI	CTYRAG	1 cut(s)	206
SmoI	CTYRAG	1 cut(s)	206
SphI	GCATGC	1 cut(s)	455
Sse9I	AATT	2 cut(s)	144, 423
SsiI	CCGC	1 cut(s)	152
SspDI	GGCGCC	1 cut(s)	80
SspMI	CTAG	2 cut(s)	473, 562
StyI	CCWWGG	1 cut(s)	74
TaaI	ACNGT	4 cut(s)	250, 331, 375, 514
TaqI	TCGA	3 cut(s)	44, 48, 387
TaqII	GACCGA	1 cut(s)	204
TasI	AATT	2 cut(s)	144, 423
Tru1I	TTAA	3 cut(s)	207, 518, 554
Tru9I	TTAA	3 cut(s)	207, 518, 554
TscAI	CASTG	2 cut(s)	36, 118
TseI	GCWGC	4 cut(s)	34, 298, 469, 506
TspDTI	ATGAA	2 cut(s)	306, 367
TspGWI	ACGGA	3 cut(s)	94, 198, 405
TspRI	CASTG	2 cut(s)	36, 118
Vha464I	CTTAAG	1 cut(s)	206
VpaK11BI	GGWCC	1 cut(s)	97
XapI	RAATTY	1 cut(s)	144
XceI	RCATGY	1 cut(s)	455
XcmI	CCANNNNNNNNNTGG	1 cut(s)	91
XmnI	GAANNNNTTC	1 cut(s)	546
XspI	CTAG	2 cut(s)	473, 562
Zsp2I	ATGCAT	1 cut(s)	457

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.