Rmu_co8068784.1_g000001

cla,cla1,def,dxps2,dxs

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8068784.1
Physical Location & Seq
Reverse (-)
2 .. 347
346 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8068784.1_g000001.1.cds

Sequence Viewer

Length: 261 bp
atggctgatgcacgattctgcaagcctcttgatggaaatttgatcagacagctagctcaagaacatgagattctcattaccgtagaagaaggatcaatcggaggattcggctcccacgtttcccaattctttggcttgaatggattacttgatggcaagctcaagtggagggctatgatgcttcctgacagatatattgaacatggatctcagaaagaccaaactgaagcagcagggttgagttccaggcatattgcaaca
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.

Protein Analysis

87

Amino Acids

9.61

Weight (kDa)

6.03

Isoelectric Point (pI)

36.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 100, 214
AcsI RAATTY 1 cut(s) 37
AcuI CTGAAG 1 cut(s) 246
AfiI CCNNNNNNNGG 1 cut(s) 32
AgsI TTSAA 2 cut(s) 139, 200
AjnI CCWGG 1 cut(s) 245
AluBI AGCT 3 cut(s) 52, 56, 160
AluI AGCT 3 cut(s) 52, 56, 160
AlwI GGATC 2 cut(s) 100, 214
ApeKI GCWGC 1 cut(s) 230
ApoI RAATTY 1 cut(s) 37
AsuNHI GCTAGC 1 cut(s) 52
BbvI GCAGC 1 cut(s) 242
BccI CCATC 2 cut(s) 26, 146
BciT130I CCWGG 1 cut(s) 247
BclI TGATCA 1 cut(s) 42
BfaI CTAG 1 cut(s) 53
BisI GCNGC 1 cut(s) 231
BlsI GCNGC 1 cut(s) 232
Bme1390I CCNGG 1 cut(s) 247
BmiI GGNNCC 1 cut(s) 112
BmrFI CCNGG 1 cut(s) 247
BmsI GCATC 1 cut(s) 168
BmtI GCTAGC 1 cut(s) 56
BpuEI CTTGAG 2 cut(s) 42, 146
Bsc4I CCNNNNNNNGG 1 cut(s) 32
BseBI CCWGG 1 cut(s) 247
BseLI CCNNNNNNNGG 1 cut(s) 32
BseMII CTCAG 1 cut(s) 224
BseXI GCAGC 1 cut(s) 242
BslI CCNNNNNNNGG 1 cut(s) 32
Bsp143I GATC 3 cut(s) 42, 92, 206
BspCNI CTCAG 1 cut(s) 223
BspLI GGNNCC 1 cut(s) 112
BspOI GCTAGC 1 cut(s) 56
BspPI GGATC 2 cut(s) 100, 214
BssMI GATC 3 cut(s) 42, 92, 206
Bst2UI CCWGG 1 cut(s) 247
Bst4CI ACNGT 1 cut(s) 82
BstC8I GCNNGC 3 cut(s) 23, 54, 158
BstDEI CTNAG 1 cut(s) 210
BstKTI GATC 3 cut(s) 45, 95, 209
BstMBI GATC 3 cut(s) 42, 92, 206
BstNI CCWGG 1 cut(s) 247
BstSCI CCNGG 1 cut(s) 245
BstV1I GCAGC 1 cut(s) 242
BstX2I RGATCY 1 cut(s) 206
BstXI CCANNNNNNTGG 1 cut(s) 131
BstYI RGATCY 1 cut(s) 206
Cac8I GCNNGC 3 cut(s) 23, 54, 158
CviAII CATG 2 cut(s) 65, 203
CviJI RGCY 8 cut(s) 5, 25, 52, 56, 111, 135, 160, 173
CviKI_1 RGCY 8 cut(s) 5, 25, 52, 56, 111, 135, 160, 173
DdeI CTNAG 1 cut(s) 210
DpnI GATC 3 cut(s) 44, 94, 208
DpnII GATC 3 cut(s) 42, 92, 206
Eco57I CTGAAG 1 cut(s) 246
EcoRII CCWGG 1 cut(s) 245
FaeI CATG 2 cut(s) 68, 206
FaiI YATR 5 cut(s) 66, 176, 195, 204, 252
FatI CATG 2 cut(s) 64, 202
FbaI TGATCA 1 cut(s) 42
Fnu4HI GCNGC 1 cut(s) 231
Fsp4HI GCNGC 1 cut(s) 231
FspBI CTAG 1 cut(s) 53
GluI GCNGC 1 cut(s) 231
Hin1II CATG 2 cut(s) 68, 206
HinfI GANTC 3 cut(s) 15, 70, 105
Hpy188I TCNGA 3 cut(s) 47, 101, 213
Hpy188III TCNNGA 3 cut(s) 29, 59, 185
HpyAV CCTTC 1 cut(s) 83
HpyCH4III ACNGT 1 cut(s) 82
HpyCH4IV ACGT 1 cut(s) 117
HpyCH4V TGCA 3 cut(s) 11, 21, 257
HpyF3I CTNAG 1 cut(s) 210
HpySE526I ACGT 1 cut(s) 117
Hsp92II CATG 2 cut(s) 68, 206
Ksp22I TGATCA 1 cut(s) 42
Kzo9I GATC 3 cut(s) 42, 92, 206
LmnI GCTCC 1 cut(s) 116
LpnPI CCDG 3 cut(s) 198, 219, 232
Lsp1109I GCAGC 1 cut(s) 242
LweI GCATC 1 cut(s) 168
MaeI CTAG 1 cut(s) 53
MaeII ACGT 1 cut(s) 117
MalI GATC 3 cut(s) 44, 94, 208
MboI GATC 3 cut(s) 42, 92, 206
MboII GAAGA 1 cut(s) 98
MflI RGATCY 1 cut(s) 206
MluCI AATT 2 cut(s) 37, 125
MnlI CCTC 3 cut(s) 36, 95, 162
MspR9I CCNGG 1 cut(s) 247
MvaI CCWGG 1 cut(s) 247
NdeII GATC 3 cut(s) 42, 92, 206
NheI GCTAGC 1 cut(s) 52
NlaIII CATG 2 cut(s) 68, 206
NlaIV GGNNCC 1 cut(s) 112
PcsI WCGNNNNNNNCGW 1 cut(s) 114
PfeI GAWTC 3 cut(s) 15, 70, 105
PkrI GCNGC 1 cut(s) 232
Psp6I CCWGG 1 cut(s) 245
PspGI CCWGG 1 cut(s) 245
PspN4I GGNNCC 1 cut(s) 112
PsuI RGATCY 1 cut(s) 206
SatI GCNGC 1 cut(s) 231
Sau3AI GATC 3 cut(s) 42, 92, 206
ScrFI CCNGG 1 cut(s) 247
SetI ASST 4 cut(s) 54, 58, 120, 162
SfaNI GCATC 1 cut(s) 168
SmlI CTYRAG 2 cut(s) 57, 161
SmoI CTYRAG 2 cut(s) 57, 161
Sse9I AATT 2 cut(s) 37, 125
SspMI CTAG 1 cut(s) 53
StyD4I CCNGG 1 cut(s) 245
TaaI ACNGT 1 cut(s) 82
TaiI ACGT 1 cut(s) 120
TasI AATT 2 cut(s) 37, 125
TfiI GAWTC 3 cut(s) 15, 70, 105
TseI GCWGC 1 cut(s) 230
XapI RAATTY 1 cut(s) 37
XspI CTAG 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.