pycom17g06470

PI-PLC X domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0001750
Physical Location & Seq
Forward (+)
4646388 .. 4647883
1496 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g06470.5

Sequence Viewer

Length: 876 bp
ATGCACTCGTTAAAGTGGTTTAGTCATATTTCTCAATTAATCCTTGACCTTTTGCAGAATGGGGTTCGAGCCTTGATGCTCGATACGTATGATTTTAAGGACGATGTGTGGTTGTGCCATTCTTTTAATGGACAATGCTATGACTTTACTGCATTTGAACCAGCTATAGATACACTGAAGGAAGTTGAAGCATTTTTATCAGCCAACCCATCAGAAATTGTGACATTGATATTGGAGGACTATGTGGAAGCTCCAAATGGATTGACAAACGTCTTCAACGCTTCCGGGTTGAAGAACTATTGGTTTCCGGTGACAAGCATGCCCAAAAATGGCCAGGACTGGCCACTTGTTAGTGACATGGTTGCCAATAACCAAAGGCTACTTGTGTTTACTTCAAAAAGTGCGAAGGAACAATCCGAAGGAATCGCTTACCAGTGGAACTACATGGTTGAAAACCAATATGGGGATGATGGAATGAAGGAAGGAAGTTGTTCAAATAGAGGAGAATCATCACCTCTTGATGACAAAACTAAATCTTTGGTTTTGGTGAATTATTTTGCTTCTATTCCCTTGAAGCTAGAAAGTTGCGAAAATAACTCTGGGGATCTGATTAACATGCTTTACACTTGTCATGGTGCTGCTGCCAACCGATGGGCTAACTTTGTTGCTGTTGATTTTTACAAGGCATGCCCTCTCTTCCCCTGCTTAATAACCACTGAAAAAGGAGTGAAGGGGGAGGATCGTTTCAAGCTTTGGACAATCTCAATGGGGAGCTCTTGTGTGGATGTAACGATGTACATGCATGTGTGCCGGGATCACCTCAAGGGTCTTGCCAGCCATAGGAGACACAATACAAATTCATGTAATGAAGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

292

Amino Acids

32.83

Weight (kDa)

5.15

Isoelectric Point (pI)

40.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 651
AclWI GGATC 3 cut(s) 612, 747, 822
AcoI YGGCCR 2 cut(s) 331, 341
AcsI RAATTY 1 cut(s) 856
AcuI CTGAAG 1 cut(s) 197
AfaI GTAC 1 cut(s) 797
AfiI CCNNNNNNNGG 4 cut(s) 329, 463, 651, 840
AgsI TTSAA 9 cut(s) 158, 188, 277, 292, 396, 452, 495, 574, 748
AjnI CCWGG 1 cut(s) 333
AluBI AGCT 6 cut(s) 164, 251, 577, 751, 774, 872
AluI AGCT 6 cut(s) 164, 251, 577, 751, 774, 872
Alw21I GWGCWC 1 cut(s) 776
Alw26I GTCTC 1 cut(s) 838
AlwI GGATC 3 cut(s) 612, 747, 822
AoxI GGCC 2 cut(s) 331, 341
ApeKI GCWGC 2 cut(s) 638, 641
ApoI RAATTY 1 cut(s) 856
AseI ATTAAT 1 cut(s) 38
Asp700I GAANNNNTTC 1 cut(s) 490
AsuC2I CCSGG 2 cut(s) 286, 812
AsuHPI GGTGA 4 cut(s) 322, 504, 559, 809
BalI TGGCCA 2 cut(s) 333, 343
BanII GRGCYC 1 cut(s) 776
BbsI GAAGAC 1 cut(s) 265
Bbv12I GWGCWC 1 cut(s) 776
BbvI GCAGC 2 cut(s) 625, 628
BccI CCATC 3 cut(s) 217, 464, 645
BcgI CGANNNNNNTGC 2 cut(s) 781, 815
BciT130I CCWGG 1 cut(s) 335
BcnI CCSGG 2 cut(s) 286, 812
BcoDI GTCTC 1 cut(s) 838
BfaI CTAG 1 cut(s) 578
BfmI CTRYAG 1 cut(s) 165
BisI GCNGC 2 cut(s) 639, 642
BlsI GCNGC 2 cut(s) 640, 643
Bme1390I CCNGG 3 cut(s) 286, 335, 812
BmrFI CCNGG 3 cut(s) 286, 335, 812
BmsI GCATC 1 cut(s) 66
BoxI GACNNNNGTC 1 cut(s) 269
BpiI GAAGAC 1 cut(s) 265
BpuEI CTTGAG 1 cut(s) 806
BpuMI CCSGG 2 cut(s) 286, 812
BsaAI YACGTR 1 cut(s) 87
BsaWI WCCGGW 1 cut(s) 307
BsaXI ACNNNNNCTCC 2 cut(s) 763, 793
Bsc4I CCNNNNNNNGG 4 cut(s) 329, 463, 651, 840
Bse1I ACTGG 2 cut(s) 344, 433
BseBI CCWGG 1 cut(s) 335
BseGI GGATG 2 cut(s) 472, 790
BseLI CCNNNNNNNGG 4 cut(s) 329, 463, 651, 840
BseNI ACTGG 2 cut(s) 344, 433
BseRI GAGGAG 1 cut(s) 516
BseXI GCAGC 2 cut(s) 625, 628
BshFI GGCC 2 cut(s) 333, 343
BsiHKAI GWGCWC 1 cut(s) 776
BsiSI CCGG 3 cut(s) 285, 308, 811
BslI CCNNNNNNNGG 4 cut(s) 329, 463, 651, 840
BsmAI GTCTC 1 cut(s) 838
BsnI GGCC 2 cut(s) 333, 343
Bsp1286I GDGCHC 1 cut(s) 776
Bsp1407I TGTACA 1 cut(s) 795
Bsp143I GATC 3 cut(s) 604, 739, 814
BspANI GGCC 2 cut(s) 333, 343
BspPI GGATC 3 cut(s) 612, 747, 822
BsrGI TGTACA 1 cut(s) 795
BsrI ACTGG 2 cut(s) 344, 433
BssMI GATC 3 cut(s) 604, 739, 814
Bst2UI CCWGG 1 cut(s) 335
Bst6I CTCTTC 1 cut(s) 701
BstAUI TGTACA 1 cut(s) 795
BstBAI YACGTR 1 cut(s) 87
BstC8I GCNNGC 3 cut(s) 320, 688, 835
BstF5I GGATG 2 cut(s) 472, 790
BstKTI GATC 3 cut(s) 607, 742, 817
BstMAI GTCTC 1 cut(s) 838
BstMBI GATC 3 cut(s) 604, 739, 814
BstNI CCWGG 1 cut(s) 335
BstNSI RCATGY 5 cut(s) 322, 619, 690, 802, 806
BstPAI GACNNNNGTC 1 cut(s) 269
BstSCI CCNGG 3 cut(s) 284, 333, 810
BstSFI CTRYAG 1 cut(s) 165
BstSNI TACGTA 1 cut(s) 87
BstV1I GCAGC 2 cut(s) 625, 628
BstV2I GAAGAC 1 cut(s) 265
BstX2I RGATCY 1 cut(s) 604
BstYI RGATCY 1 cut(s) 604
BsuRI GGCC 2 cut(s) 333, 343
BtsCI GGATG 2 cut(s) 472, 790
BtsIMutI CAGTG 3 cut(s) 173, 440, 714
Cac8I GCNNGC 3 cut(s) 320, 688, 835
Csp6I GTAC 1 cut(s) 796
CviAII CATG 9 cut(s) 319, 358, 445, 616, 632, 687, 799, 803, 861
CviQI GTAC 1 cut(s) 796
DpnI GATC 3 cut(s) 606, 741, 816
DpnII GATC 3 cut(s) 604, 739, 814
EaeI YGGCCR 2 cut(s) 331, 341
Eam1104I CTCTTC 1 cut(s) 701
EarI CTCTTC 1 cut(s) 701
Ecl136II GAGCTC 1 cut(s) 774
Eco105I TACGTA 1 cut(s) 87
Eco24I GRGCYC 1 cut(s) 776
Eco53kI GAGCTC 1 cut(s) 774
Eco57I CTGAAG 1 cut(s) 197
EcoICRI GAGCTC 1 cut(s) 774
EcoRII CCWGG 1 cut(s) 333
EcoT22I ATGCAT 1 cut(s) 804
EcoT38I GRGCYC 1 cut(s) 776
FaeI CATG 9 cut(s) 322, 361, 448, 619, 635, 690, 802, 806, 864
FatI CATG 9 cut(s) 318, 357, 444, 615, 631, 686, 798, 802, 860
Fnu4HI GCNGC 2 cut(s) 639, 642
FokI GGATG 2 cut(s) 479, 797
FriOI GRGCYC 1 cut(s) 776
Fsp4HI GCNGC 2 cut(s) 639, 642
FspBI CTAG 1 cut(s) 578
GluI GCNGC 2 cut(s) 639, 642
HaeIII GGCC 2 cut(s) 333, 343
HapII CCGG 3 cut(s) 285, 308, 811
Hin1II CATG 9 cut(s) 322, 361, 448, 619, 635, 690, 802, 806, 864
HindIII AAGCTT 2 cut(s) 749, 870
HinfI GANTC 2 cut(s) 423, 506
HpaII CCGG 3 cut(s) 285, 308, 811
HphI GGTGA 4 cut(s) 322, 504, 559, 809
Hpy166II GTNNAC 1 cut(s) 390
Hpy188I TCNGA 3 cut(s) 214, 418, 609
Hpy188III TCNNGA 1 cut(s) 518
Hpy8I GTNNAC 1 cut(s) 390
HpyAV CCTTC 6 cut(s) 172, 400, 413, 472, 476, 724
HpyCH4IV ACGT 2 cut(s) 86, 270
HpyCH4V TGCA 4 cut(s) 4, 55, 152, 802
HpySE526I ACGT 2 cut(s) 86, 270
Hsp92II CATG 9 cut(s) 322, 361, 448, 619, 635, 690, 802, 806, 864
Kzo9I GATC 3 cut(s) 604, 739, 814
LmnI GCTCC 2 cut(s) 256, 771
Lsp1109I GCAGC 2 cut(s) 625, 628
LweI GCATC 1 cut(s) 66
MaeI CTAG 1 cut(s) 578
MaeII ACGT 2 cut(s) 86, 270
MaeIII GTNAC 4 cut(s) 220, 310, 353, 787
MalI GATC 3 cut(s) 606, 741, 816
MboI GATC 3 cut(s) 604, 739, 814
MboII GAAGA 3 cut(s) 265, 304, 688
MflI RGATCY 1 cut(s) 604
MhlI GDGCHC 1 cut(s) 776
MlsI TGGCCA 2 cut(s) 333, 343
MluCI AATT 4 cut(s) 35, 216, 550, 856
MluNI TGGCCA 2 cut(s) 333, 343
MnlI CCTC 6 cut(s) 229, 494, 525, 702, 730, 830
Mox20I TGGCCA 2 cut(s) 333, 343
Mph1103I ATGCAT 1 cut(s) 804
MroXI GAANNNNTTC 1 cut(s) 490
MscI TGGCCA 2 cut(s) 333, 343
MseI TTAA 7 cut(s) 11, 38, 96, 126, 612, 707, 874
MslI CAYNNNNRTG 1 cut(s) 803
Msp20I TGGCCA 2 cut(s) 333, 343
MspI CCGG 3 cut(s) 285, 308, 811
MspR9I CCNGG 3 cut(s) 286, 335, 812
MvaI CCWGG 1 cut(s) 335
NciI CCSGG 2 cut(s) 286, 812
NdeII GATC 3 cut(s) 604, 739, 814
NlaIII CATG 9 cut(s) 322, 361, 448, 619, 635, 690, 802, 806, 864
NmuCI GTSAC 3 cut(s) 220, 310, 353
NsiI ATGCAT 1 cut(s) 804
NspI RCATGY 5 cut(s) 322, 619, 690, 802, 806
PaeI GCATGC 2 cut(s) 322, 690
PdmI GAANNNNTTC 1 cut(s) 490
PfeI GAWTC 2 cut(s) 423, 506
PflMI CCANNNNNTGG 1 cut(s) 651
PkrI GCNGC 2 cut(s) 640, 643
Ppu21I YACGTR 1 cut(s) 87
PshAI GACNNNNGTC 1 cut(s) 269
PshBI ATTAAT 1 cut(s) 38
Psp124BI GAGCTC 1 cut(s) 776
Psp6I CCWGG 1 cut(s) 333
PspGI CCWGG 1 cut(s) 333
PsuI RGATCY 1 cut(s) 604
RsaI GTAC 1 cut(s) 797
RsaNI GTAC 1 cut(s) 796
RseI CAYNNNNRTG 1 cut(s) 803
SacI GAGCTC 1 cut(s) 776
SaqAI TTAA 7 cut(s) 11, 38, 96, 126, 612, 707, 874
SatI GCNGC 2 cut(s) 639, 642
Sau3AI GATC 3 cut(s) 604, 739, 814
ScrFI CCNGG 3 cut(s) 286, 335, 812
SduI GDGCHC 1 cut(s) 776
SfaNI GCATC 1 cut(s) 66
SfcI CTRYAG 1 cut(s) 165
SmiMI CAYNNNNRTG 1 cut(s) 803
SmlI CTYRAG 1 cut(s) 821
SmoI CTYRAG 1 cut(s) 821
SnaBI TACGTA 1 cut(s) 87
SphI GCATGC 2 cut(s) 322, 690
Sse9I AATT 4 cut(s) 35, 216, 550, 856
SspMI CTAG 1 cut(s) 578
SstI GAGCTC 1 cut(s) 776
StyD4I CCNGG 3 cut(s) 284, 333, 810
TaiI ACGT 2 cut(s) 89, 273
TaqI TCGA 2 cut(s) 67, 81
TasI AATT 4 cut(s) 35, 216, 550, 856
TatI WGTACW 1 cut(s) 795
TfiI GAWTC 2 cut(s) 423, 506
Tru1I TTAA 7 cut(s) 11, 38, 96, 126, 612, 707, 874
Tru9I TTAA 7 cut(s) 11, 38, 96, 126, 612, 707, 874
TscAI CASTG 3 cut(s) 180, 440, 721
TseFI GTSAC 3 cut(s) 220, 310, 353
TseI GCWGC 2 cut(s) 638, 641
Tsp45I GTSAC 3 cut(s) 220, 310, 353
TspDTI ATGAA 2 cut(s) 491, 849
TspRI CASTG 3 cut(s) 180, 440, 721
Van91I CCANNNNNTGG 1 cut(s) 651
VspI ATTAAT 1 cut(s) 38
XapI RAATTY 1 cut(s) 856
XceI RCATGY 5 cut(s) 322, 619, 690, 802, 806
XcmI CCANNNNNNNNNTGG 1 cut(s) 125
XmnI GAANNNNTTC 1 cut(s) 490
XspI CTAG 1 cut(s) 578
Zsp2I ATGCAT 1 cut(s) 804
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.