Rmu_sc0001097.1_g000040

PI-PLC X domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001097.1
OG0001750
Physical Location & Seq
Forward (+)
151362 .. 154241
2880 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001097.1_g000040.1.cds

Sequence Viewer

Length: 1113 bp
atgaagacgactcggcacagcttccttctggttctacttctggttatgtctcttgctgtgttttcatgtgtagtcatagcttgctccgatggacagtgcaagctcttagatcagtgctcgacagacggagattgtgaggcggggctttactgtttcagttgcccttttgagtttttaggctccagatgtgtgagatcaaccaccaccaaccaattccagcttttgaatagttccctaccattcaacaaatatgcatttttgacaacccacaatgcttttgccatcgaaggagagccatctcatactggagtctctcgttttcccttgacgactagtcaagaagacactgtcactcaacaacttaacaatggagttagagccctgatgcttgatacctatgattttaaaggagatgtctggttgtgccattccttattcgaaggacaatgtaatgacaacactgcatttgagccagctatagatacattaaaagaaatccaagcatttttatcagcaaatccaggagaaattgtgacattgatattagaggactatgttgaagctccaaacggattgacaaatgttttcaaatctgccggattgatgaaatactggtttccggtatcaaacatgcccaaaagtggtcaggattggccgctggttagcgatatggttgccaagaaccaaaggctacttgtattcacttcaaaacaagagaaggaacaatccgaagggattgcataccagtggaactacatggttgaaaacgagtatggagatgatggaatggaagagggaagctgttcaaacagaggtgaatcgtcgcctttaaatgacaagactaaatcattggtgctggttaaccattttcaatcacttcccattaagaagctctcatgtctattcaattctgaggatttggttagcaagcttaacacttgctgtggtgctgctggaaaccgatgggcaaattttgttgcggttgatttttacaagaggagtggaggggggggatcgtttcaagctacagacactgttaatggagaactcatatgtggatgtaacaatatccatgcatgtgtgccaggatcaacaacaccctgtaaggtatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

370

Amino Acids

40.7

Weight (kDa)

4.93

Isoelectric Point (pI)

41.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 140, 656, 980
AclWI GGATC 2 cut(s) 1021, 1096
AcoI YGGCCR 1 cut(s) 653
AcsI RAATTY 1 cut(s) 970
AfiI CCNNNNNNNGG 1 cut(s) 641
AhdI GACNNNNNGTC 1 cut(s) 333
AhlI ACTAGT 1 cut(s) 332
AjnI CCWGG 2 cut(s) 520, 1084
Alw21I GWGCWC 1 cut(s) 119
Alw26I GTCTC 2 cut(s) 54, 316
AlwI GGATC 2 cut(s) 1021, 1096
AlwNI CAGNNNCTG 1 cut(s) 1034
AoxI GGCC 1 cut(s) 653
ApeKI GCWGC 1 cut(s) 950
ApoI RAATTY 1 cut(s) 970
Asp700I GAANNNNTTC 1 cut(s) 802
AsuHPI GGTGA 1 cut(s) 827
AsuII TTCGAA 1 cut(s) 438
BanII GRGCYC 1 cut(s) 382
BbsI GAAGAC 2 cut(s) 11, 348
Bbv12I GWGCWC 1 cut(s) 119
BbvI GCAGC 1 cut(s) 937
BccI CCATC 5 cut(s) 83, 290, 304, 776, 957
BcgI CGANNNNNNTGC 4 cut(s) 656, 690, 719, 753
BciT130I CCWGG 2 cut(s) 522, 1086
BcoDI GTCTC 2 cut(s) 54, 316
BcuI ACTAGT 1 cut(s) 332
BfaI CTAG 1 cut(s) 333
BfmI CTRYAG 2 cut(s) 477, 1026
BisI GCNGC 2 cut(s) 656, 951
BlsI GCNGC 2 cut(s) 657, 952
Bme1390I CCNGG 2 cut(s) 522, 1086
BmeRI GACNNNNNGTC 1 cut(s) 333
BmiI GGNNCC 1 cut(s) 181
BmrFI CCNGG 2 cut(s) 522, 1086
BmsI GCATC 1 cut(s) 375
BpiI GAAGAC 2 cut(s) 11, 348
BpmI CTGGAG 2 cut(s) 166, 327
Bpu14I TTCGAA 1 cut(s) 438
BsaWI WCCGGW 1 cut(s) 619
BsaXI ACNNNNNCTCC 2 cut(s) 516, 546
Bsc4I CCNNNNNNNGG 1 cut(s) 641
Bse1I ACTGG 3 cut(s) 310, 617, 745
BseBI CCWGG 2 cut(s) 522, 1086
BseGI GGATG 1 cut(s) 1064
BseLI CCNNNNNNNGG 1 cut(s) 641
BseMII CTCAG 1 cut(s) 903
BseNI ACTGG 3 cut(s) 310, 617, 745
BseRI GAGGAG 1 cut(s) 1012
BseXI GCAGC 1 cut(s) 937
BshFI GGCC 1 cut(s) 655
BsiHKAI GWGCWC 1 cut(s) 119
BsiSI CCGG 2 cut(s) 597, 620
BslI CCNNNNNNNGG 1 cut(s) 641
BsmAI GTCTC 2 cut(s) 54, 316
BsnI GGCC 1 cut(s) 655
Bsp119I TTCGAA 1 cut(s) 438
Bsp1286I GDGCHC 2 cut(s) 119, 382
Bsp143I GATC 4 cut(s) 109, 194, 1013, 1088
BspACI CCGC 3 cut(s) 140, 656, 980
BspANI GGCC 1 cut(s) 655
BspCNI CTCAG 1 cut(s) 904
BspLI GGNNCC 1 cut(s) 181
BspPI GGATC 2 cut(s) 1021, 1096
BspT104I TTCGAA 1 cut(s) 438
BsrI ACTGG 3 cut(s) 310, 617, 745
BssMI GATC 4 cut(s) 109, 194, 1013, 1088
Bst2UI CCWGG 2 cut(s) 522, 1086
Bst4CI ACNGT 4 cut(s) 96, 152, 349, 1036
Bst6I CTCTTC 1 cut(s) 786
BstBI TTCGAA 1 cut(s) 438
BstC8I GCNNGC 4 cut(s) 82, 101, 474, 929
BstDEI CTNAG 2 cut(s) 106, 912
BstF5I GGATG 1 cut(s) 1064
BstKTI GATC 4 cut(s) 112, 197, 1016, 1091
BstMAI GTCTC 2 cut(s) 54, 316
BstMBI GATC 4 cut(s) 109, 194, 1013, 1088
BstNI CCWGG 2 cut(s) 522, 1086
BstNSI RCATGY 2 cut(s) 634, 1080
BstSCI CCNGG 2 cut(s) 520, 1084
BstSFI CTRYAG 2 cut(s) 477, 1026
BstV1I GCAGC 1 cut(s) 937
BstV2I GAAGAC 2 cut(s) 11, 348
BsuRI GGCC 1 cut(s) 655
BtsCI GGATG 1 cut(s) 1064
BtsI GCAGTG 1 cut(s) 459
BtsIMutI CAGTG 6 cut(s) 101, 119, 345, 459, 752, 1032
Cac8I GCNNGC 4 cut(s) 82, 101, 474, 929
CaiI CAGNNNCTG 1 cut(s) 1034
CspCI CAANNNNNGTGG 2 cut(s) 982, 1017
CviAII CATG 6 cut(s) 66, 631, 757, 897, 1073, 1077
DdeI CTNAG 2 cut(s) 106, 912
DpnI GATC 4 cut(s) 111, 196, 1015, 1090
DpnII GATC 4 cut(s) 109, 194, 1013, 1088
DraI TTTAAA 2 cut(s) 406, 831
DriI GACNNNNNGTC 1 cut(s) 333
EaeI YGGCCR 1 cut(s) 653
Eam1104I CTCTTC 1 cut(s) 786
Eam1105I GACNNNNNGTC 1 cut(s) 333
EarI CTCTTC 1 cut(s) 786
Eco24I GRGCYC 1 cut(s) 382
EcoRII CCWGG 2 cut(s) 520, 1084
EcoT22I ATGCAT 2 cut(s) 256, 1078
EcoT38I GRGCYC 1 cut(s) 382
FaeI CATG 6 cut(s) 69, 634, 760, 900, 1076, 1080
FatI CATG 6 cut(s) 65, 630, 756, 896, 1072, 1076
FauI CCCGC 1 cut(s) 133
FauNDI CATATG 1 cut(s) 1052
Fnu4HI GCNGC 2 cut(s) 656, 951
FokI GGATG 1 cut(s) 1071
FriOI GRGCYC 1 cut(s) 382
Fsp4HI GCNGC 2 cut(s) 656, 951
FspBI CTAG 1 cut(s) 333
GluI GCNGC 2 cut(s) 656, 951
GsuI CTGGAG 2 cut(s) 166, 327
HaeIII GGCC 1 cut(s) 655
HapII CCGG 2 cut(s) 597, 620
Hin1II CATG 6 cut(s) 69, 634, 760, 900, 1076, 1080
HincII GTYRAC 1 cut(s) 862
HindII GTYRAC 1 cut(s) 862
HindIII AAGCTT 1 cut(s) 929
HinfI GANTC 3 cut(s) 10, 309, 818
HpaI GTTAAC 1 cut(s) 862
HpaII CCGG 2 cut(s) 597, 620
HphI GGTGA 1 cut(s) 827
Hpy166II GTNNAC 1 cut(s) 862
Hpy188I TCNGA 3 cut(s) 88, 730, 913
Hpy188III TCNNGA 3 cut(s) 183, 338, 647
Hpy8I GTNNAC 1 cut(s) 862
Hpy99I CGWCG 1 cut(s) 826
HpyAV CCTTC 5 cut(s) 35, 281, 434, 712, 725
HpyCH4III ACNGT 4 cut(s) 96, 152, 349, 1036
HpyCH4V TGCA 5 cut(s) 99, 254, 464, 740, 1076
HpyF3I CTNAG 2 cut(s) 106, 912
Hsp92II CATG 6 cut(s) 69, 634, 760, 900, 1076, 1080
KspAI GTTAAC 1 cut(s) 862
Kzo9I GATC 4 cut(s) 109, 194, 1013, 1088
LmnI GCTCC 3 cut(s) 89, 185, 568
Lsp1109I GCAGC 1 cut(s) 937
LweI GCATC 1 cut(s) 375
MaeI CTAG 1 cut(s) 333
MaeIII GTNAC 3 cut(s) 349, 532, 1061
MalI GATC 4 cut(s) 111, 196, 1015, 1090
MboI GATC 4 cut(s) 109, 194, 1013, 1088
MboII GAAGA 3 cut(s) 16, 353, 803
MhlI GDGCHC 2 cut(s) 119, 382
MluCI AATT 4 cut(s) 212, 528, 907, 970
MlyI GAGTC 2 cut(s) 4, 318
MnlI CCTC 7 cut(s) 130, 541, 787, 806, 907, 990, 998
Mph1103I ATGCAT 2 cut(s) 256, 1078
MroXI GAANNNNTTC 1 cut(s) 802
MseI TTAA 8 cut(s) 363, 405, 488, 830, 861, 885, 933, 1038
MslI CAYNNNNRTG 2 cut(s) 745, 1077
MspA1I CMGCKG 1 cut(s) 658
MspI CCGG 2 cut(s) 597, 620
MspR9I CCNGG 2 cut(s) 522, 1086
MvaI CCWGG 2 cut(s) 522, 1086
NdeI CATATG 1 cut(s) 1052
NdeII GATC 4 cut(s) 109, 194, 1013, 1088
NlaIII CATG 6 cut(s) 69, 634, 760, 900, 1076, 1080
NlaIV GGNNCC 1 cut(s) 181
NmuCI GTSAC 2 cut(s) 349, 532
NsiI ATGCAT 2 cut(s) 256, 1078
NspI RCATGY 2 cut(s) 634, 1080
NspV TTCGAA 1 cut(s) 438
PdmI GAANNNNTTC 1 cut(s) 802
PfeI GAWTC 1 cut(s) 818
PflFI GACNNNGTC 1 cut(s) 347
PfoI TCCNGGA 1 cut(s) 520
PkrI GCNGC 2 cut(s) 657, 952
PleI GAGTC 2 cut(s) 4, 317
PpsI GAGTC 2 cut(s) 4, 317
Psp6I CCWGG 2 cut(s) 520, 1084
PspGI CCWGG 2 cut(s) 520, 1084
PspN4I GGNNCC 1 cut(s) 181
PstNI CAGNNNCTG 1 cut(s) 1034
PsyI GACNNNGTC 1 cut(s) 347
RseI CAYNNNNRTG 2 cut(s) 745, 1077
SaqAI TTAA 8 cut(s) 363, 405, 488, 830, 861, 885, 933, 1038
SatI GCNGC 2 cut(s) 656, 951
Sau3AI GATC 4 cut(s) 109, 194, 1013, 1088
SchI GAGTC 2 cut(s) 4, 318
ScrFI CCNGG 2 cut(s) 522, 1086
SduI GDGCHC 2 cut(s) 119, 382
SfaNI GCATC 1 cut(s) 375
SfcI CTRYAG 2 cut(s) 477, 1026
SfuI TTCGAA 1 cut(s) 438
SmiMI CAYNNNNRTG 2 cut(s) 745, 1077
SpeI ACTAGT 1 cut(s) 332
Sse9I AATT 4 cut(s) 212, 528, 907, 970
SsiI CCGC 3 cut(s) 140, 656, 980
SspMI CTAG 1 cut(s) 333
StyD4I CCNGG 2 cut(s) 520, 1084
TaaI ACNGT 4 cut(s) 96, 152, 349, 1036
TaqI TCGA 3 cut(s) 119, 285, 438
TasI AATT 4 cut(s) 212, 528, 907, 970
TauI GCSGC 1 cut(s) 658
TfiI GAWTC 1 cut(s) 818
Tru1I TTAA 8 cut(s) 363, 405, 488, 830, 861, 885, 933, 1038
Tru9I TTAA 8 cut(s) 363, 405, 488, 830, 861, 885, 933, 1038
TscAI CASTG 6 cut(s) 101, 119, 352, 466, 752, 1039
TseFI GTSAC 2 cut(s) 349, 532
TseI GCWGC 1 cut(s) 950
Tsp45I GTSAC 2 cut(s) 349, 532
TspDTI ATGAA 3 cut(s) 17, 54, 620
TspGWI ACGGA 2 cut(s) 141, 585
TspRI CASTG 6 cut(s) 101, 119, 352, 466, 752, 1039
Tth111I GACNNNGTC 1 cut(s) 347
XapI RAATTY 1 cut(s) 970
XceI RCATGY 2 cut(s) 634, 1080
XmnI GAANNNNTTC 1 cut(s) 802
XspI CTAG 1 cut(s) 333
Zsp2I ATGCAT 2 cut(s) 256, 1078
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.