Rh1AG042100

PI-PLC X domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
7298603 .. 7319165
20563 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG042100.1

Sequence Viewer

Length: 396 bp
ATGCCTCTTATTTCACTTGCAAATCTAGTAGAGCCAGCTATAAATACATTGAATGAAATCCAAGCATTTTTATCAACAAACCCAGGAGAGATAGTGACATTGATATTAGAGGACTATGTTGAAGCTCCAAATGGATTGACAAATGTTTTCAAAGCTGCAGGATTGATGAAATACTGGTTTCCGGTATCAAACATGCCCAAAAGTGGTCAGGATTGGCCGCTGGTTAGCGATATGGTCACTAAGAACCAAAGGCTACTTGTATTCACTTCAAAACTAGAGAAGGAACAATCCGAAGGGATTGCATACCAGTGGAACTACATGATTGAAAACCAGTCCAGGATCAACAACACCCTGCAAGGTATAGAATGGAGCATTAAGCAGGTGATCAAGGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

131

Amino Acids

14.88

Weight (kDa)

4.81

Isoelectric Point (pI)

42.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PI-PLC_cat PF26178 11 - 112 1.4e-51 PI-PLC-like catalytic domain
PI-PLC_X PF26146 15 - 113 9.9e-12 PI-PLC X
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 370
Acc36I ACCTGC 1 cut(s) 370
AciI CCGC 1 cut(s) 218
AclWI GGATC 1 cut(s) 347
AcoI YGGCCR 1 cut(s) 215
AfiI CCNNNNNNNGG 1 cut(s) 203
AgsI TTSAA 5 cut(s) 52, 122, 151, 270, 326
AjnI CCWGG 2 cut(s) 82, 335
AluBI AGCT 3 cut(s) 38, 125, 155
AluI AGCT 3 cut(s) 38, 125, 155
AlwI GGATC 1 cut(s) 347
AoxI GGCC 1 cut(s) 215
ApeKI GCWGC 1 cut(s) 155
AsuHPI GGTGA 1 cut(s) 394
BbvI GCAGC 1 cut(s) 142
BcgI CGANNNNNNTGC 2 cut(s) 281, 315
BciT130I CCWGG 2 cut(s) 84, 337
BclI TGATCA 1 cut(s) 384
BfaI CTAG 2 cut(s) 26, 275
BfmI CTRYAG 1 cut(s) 156
BfuAI ACCTGC 1 cut(s) 370
BisI GCNGC 2 cut(s) 156, 218
BlsI GCNGC 2 cut(s) 157, 219
Bme1390I CCNGG 2 cut(s) 84, 337
BmrFI CCNGG 2 cut(s) 84, 337
BsaJI CCNNGG 1 cut(s) 82
BsaWI WCCGGW 1 cut(s) 181
BsaXI ACNNNNNCTCC 2 cut(s) 78, 108
Bsc4I CCNNNNNNNGG 1 cut(s) 203
Bse1I ACTGG 3 cut(s) 179, 307, 331
BseBI CCWGG 2 cut(s) 84, 337
BseDI CCNNGG 1 cut(s) 82
BseLI CCNNNNNNNGG 1 cut(s) 203
BseNI ACTGG 3 cut(s) 179, 307, 331
BseXI GCAGC 1 cut(s) 142
BshFI GGCC 1 cut(s) 217
BsiSI CCGG 1 cut(s) 182
BslI CCNNNNNNNGG 1 cut(s) 203
BsnI GGCC 1 cut(s) 217
Bsp143I GATC 2 cut(s) 339, 384
BspACI CCGC 1 cut(s) 218
BspANI GGCC 1 cut(s) 217
BspMAI CTGCAG 1 cut(s) 160
BspMI ACCTGC 1 cut(s) 370
BspPI GGATC 1 cut(s) 347
BsrI ACTGG 3 cut(s) 179, 307, 331
BssECI CCNNGG 1 cut(s) 82
BssMI GATC 2 cut(s) 339, 384
Bst2UI CCWGG 2 cut(s) 84, 337
BstC8I GCNNGC 1 cut(s) 36
BstDEI CTNAG 1 cut(s) 240
BstKTI GATC 2 cut(s) 342, 387
BstMBI GATC 2 cut(s) 339, 384
BstNI CCWGG 2 cut(s) 84, 337
BstNSI RCATGY 1 cut(s) 196
BstSCI CCNGG 2 cut(s) 82, 335
BstSFI CTRYAG 1 cut(s) 156
BstV1I GCAGC 1 cut(s) 142
BsuRI GGCC 1 cut(s) 217
BtsIMutI CAGTG 1 cut(s) 314
BveI ACCTGC 1 cut(s) 370
Cac8I GCNNGC 1 cut(s) 36
CviAII CATG 2 cut(s) 193, 319
CviJI RGCY 6 cut(s) 34, 38, 125, 155, 217, 253
CviKI_1 RGCY 6 cut(s) 34, 38, 125, 155, 217, 253
DdeI CTNAG 1 cut(s) 240
DpnI GATC 2 cut(s) 341, 386
DpnII GATC 2 cut(s) 339, 384
EaeI YGGCCR 1 cut(s) 215
EcoRII CCWGG 2 cut(s) 82, 335
FaeI CATG 2 cut(s) 196, 322
FaiI YATR 7 cut(s) 41, 117, 194, 233, 304, 320, 362
FatI CATG 2 cut(s) 192, 318
FbaI TGATCA 1 cut(s) 384
Fnu4HI GCNGC 2 cut(s) 156, 218
Fsp4HI GCNGC 2 cut(s) 156, 218
FspBI CTAG 2 cut(s) 26, 275
GluI GCNGC 2 cut(s) 156, 218
HaeIII GGCC 1 cut(s) 217
HapII CCGG 1 cut(s) 182
Hin1II CATG 2 cut(s) 196, 322
HpaII CCGG 1 cut(s) 182
HphI GGTGA 1 cut(s) 394
Hpy188I TCNGA 1 cut(s) 292
Hpy188III TCNNGA 1 cut(s) 209
HpyAV CCTTC 2 cut(s) 274, 287
HpyCH4V TGCA 4 cut(s) 20, 158, 302, 355
HpyF3I CTNAG 1 cut(s) 240
Hsp92II CATG 2 cut(s) 196, 322
Ksp22I TGATCA 1 cut(s) 384
Kzo9I GATC 2 cut(s) 339, 384
LmnI GCTCC 2 cut(s) 130, 369
Lsp1109I GCAGC 1 cut(s) 142
MaeI CTAG 2 cut(s) 26, 275
MaeIII GTNAC 2 cut(s) 94, 235
MalI GATC 2 cut(s) 341, 386
MboI GATC 2 cut(s) 339, 384
MnlI CCTC 2 cut(s) 15, 103
MseI TTAA 1 cut(s) 375
MslI CAYNNNNRTG 1 cut(s) 307
MspA1I CMGCKG 1 cut(s) 220
MspI CCGG 1 cut(s) 182
MspR9I CCNGG 2 cut(s) 84, 337
MvaI CCWGG 2 cut(s) 84, 337
NdeII GATC 2 cut(s) 339, 384
NlaIII CATG 2 cut(s) 196, 322
NmuCI GTSAC 2 cut(s) 94, 235
NspI RCATGY 1 cut(s) 196
PaqCI CACCTGC 1 cut(s) 370
PfoI TCCNGGA 1 cut(s) 335
PkrI GCNGC 2 cut(s) 157, 219
Psp6I CCWGG 2 cut(s) 82, 335
PspGI CCWGG 2 cut(s) 82, 335
PstI CTGCAG 1 cut(s) 160
RseI CAYNNNNRTG 1 cut(s) 307
SaqAI TTAA 1 cut(s) 375
SatI GCNGC 2 cut(s) 156, 218
Sau3AI GATC 2 cut(s) 339, 384
ScrFI CCNGG 2 cut(s) 84, 337
SetI ASST 5 cut(s) 40, 127, 157, 361, 384
SfcI CTRYAG 1 cut(s) 156
SmiMI CAYNNNNRTG 1 cut(s) 307
SsiI CCGC 1 cut(s) 218
SspMI CTAG 2 cut(s) 26, 275
StyD4I CCNGG 2 cut(s) 82, 335
TauI GCSGC 1 cut(s) 220
Tru1I TTAA 1 cut(s) 375
Tru9I TTAA 1 cut(s) 375
TscAI CASTG 1 cut(s) 314
TseFI GTSAC 2 cut(s) 94, 235
TseI GCWGC 1 cut(s) 155
Tsp45I GTSAC 2 cut(s) 94, 235
TspDTI ATGAA 2 cut(s) 69, 182
TspRI CASTG 1 cut(s) 314
XceI RCATGY 1 cut(s) 196
XspI CTAG 2 cut(s) 26, 275
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.