RchiOBHm_Chr5g0055281

mediator of RNA polymerase II transcription subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
58201371 .. 58201662
292 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 198 bp
ATGGAGCTGGACAATATGGCTAACTTGTCAGACAAATGCAATTTCCAGATTCCTATGGAGGTTATTAAGTTGATAGTCGACTATGGAAAGAATCCTGATTTACTTACAAGGGATCTCATAAATAGCTGCAATGCCAAAAATGAGATCACTAAAGGCAAAACTGATACCTTCAAAGCAAATGCCGAGTTTACATTTTAG

Protein Analysis

65

Amino Acids

7.39

Weight (kDa)

4.85

Isoelectric Point (pI)

0.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med10 PF09748 2 - 59 2.3e-14 Transcription factor subunit Med10 of Mediator complex
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 78
AclWI GGATC 1 cut(s) 120
AgsI TTSAA 1 cut(s) 172
AluBI AGCT 2 cut(s) 7, 126
AluI AGCT 2 cut(s) 7, 126
AlwI GGATC 1 cut(s) 120
ApeKI GCWGC 1 cut(s) 126
BbvI GCAGC 1 cut(s) 113
BisI GCNGC 1 cut(s) 127
BlsI GCNGC 1 cut(s) 128
Bse3DI GCAATG 1 cut(s) 136
BseMI GCAATG 1 cut(s) 136
BseXI GCAGC 1 cut(s) 113
Bsp143I GATC 2 cut(s) 112, 144
BspPI GGATC 1 cut(s) 120
BsrDI GCAATG 1 cut(s) 136
BssMI GATC 2 cut(s) 112, 144
BstKTI GATC 2 cut(s) 115, 147
BstMBI GATC 2 cut(s) 112, 144
BstV1I GCAGC 1 cut(s) 113
BstX2I RGATCY 1 cut(s) 112
BstYI RGATCY 1 cut(s) 112
CviJI RGCY 3 cut(s) 7, 20, 126
CviKI_1 RGCY 3 cut(s) 7, 20, 126
DpnI GATC 2 cut(s) 114, 146
DpnII GATC 2 cut(s) 112, 144
FaiI YATR 4 cut(s) 17, 56, 84, 119
FblI GTMKAC 1 cut(s) 78
Fnu4HI GCNGC 1 cut(s) 127
Fsp4HI GCNGC 1 cut(s) 127
GluI GCNGC 1 cut(s) 127
HincII GTYRAC 1 cut(s) 79
HindII GTYRAC 1 cut(s) 79
HinfI GANTC 2 cut(s) 49, 91
Hpy166II GTNNAC 2 cut(s) 79, 189
Hpy188I TCNGA 1 cut(s) 31
Hpy188III TCNNGA 2 cut(s) 46, 95
Hpy8I GTNNAC 2 cut(s) 79, 189
HpyAV CCTTC 1 cut(s) 178
HpyCH4V TGCA 2 cut(s) 39, 129
Kzo9I GATC 2 cut(s) 112, 144
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 2 cut(s) 59, 108
Lsp1109I GCAGC 1 cut(s) 113
MalI GATC 2 cut(s) 114, 146
MboI GATC 2 cut(s) 112, 144
MflI RGATCY 1 cut(s) 112
MluCI AATT 1 cut(s) 40
MnlI CCTC 1 cut(s) 52
MseI TTAA 1 cut(s) 66
NdeII GATC 2 cut(s) 112, 144
PfeI GAWTC 2 cut(s) 49, 91
PkrI GCNGC 1 cut(s) 128
PsuI RGATCY 1 cut(s) 112
SalI GTCGAC 1 cut(s) 77
SaqAI TTAA 1 cut(s) 66
SatI GCNGC 1 cut(s) 127
Sau3AI GATC 2 cut(s) 112, 144
SetI ASST 4 cut(s) 9, 63, 128, 170
SgeI CNNG 5 cut(s) 20, 37, 58, 107, 120
Sse9I AATT 1 cut(s) 40
TaqI TCGA 1 cut(s) 78
TasI AATT 1 cut(s) 40
TfiI GAWTC 2 cut(s) 49, 91
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
TseI GCWGC 1 cut(s) 126
XmiI GTMKAC 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.