Rh7AG084100

mediator of RNA polymerase II transcription subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
6159471 .. 6160996
1526 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG084100.1

Sequence Viewer

Length: 267 bp
ATGGAAAATGGTTGGTTCTTTCGTGGGGATCTATGTCTTCTGGTCAGGCTTGGAGCCTTGGACCAGATGCAAATATTGCTGAATTCCAATGCTGGGAGTAGTGGGAATGGCGACAATGGGAAGTTAGTCCCTCAAACAAATGATACAGCAGGAGAAACAGGGGTGGACGAGCAAAACCAAAACCTGAACGAGGAAACGAAGCTTGCAGAAGGACAAAGCACATTGCCAAATGGAGATGTGAAGCATGAAGTAAAACCTGAGCCTTAA

Protein Analysis

88

Amino Acids

9.47

Weight (kDa)

4.3

Isoelectric Point (pI)

16.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 36
AcsI RAATTY 1 cut(s) 82
AfiI CCNNNNNNNGG 2 cut(s) 93, 190
AluBI AGCT 1 cut(s) 202
AluI AGCT 1 cut(s) 202
AlwI GGATC 1 cut(s) 36
ApoI RAATTY 1 cut(s) 82
AspS9I GGNCC 1 cut(s) 61
AvaII GGWCC 1 cut(s) 61
BbsI GAAGAC 1 cut(s) 29
Bme18I GGWCC 1 cut(s) 61
BmgT120I GGNCC 1 cut(s) 61
BmiI GGNNCC 1 cut(s) 55
BmsI GCATC 1 cut(s) 57
BpiI GAAGAC 1 cut(s) 29
Bpu10I CCTNAGC 1 cut(s) 258
BsaJI CCNNGG 1 cut(s) 57
Bsc4I CCNNNNNNNGG 2 cut(s) 93, 190
Bse3DI GCAATG 1 cut(s) 221
BseDI CCNNGG 1 cut(s) 57
BseLI CCNNNNNNNGG 2 cut(s) 93, 190
BseMI GCAATG 1 cut(s) 221
BseMII CTCAG 1 cut(s) 249
BseYI CCCAGC 1 cut(s) 92
BslFI GGGAC 1 cut(s) 113
BslI CCNNNNNNNGG 2 cut(s) 93, 190
BsmFI GGGAC 1 cut(s) 113
Bsp143I GATC 1 cut(s) 28
BspCNI CTCAG 1 cut(s) 250
BspLI GGNNCC 1 cut(s) 55
BspPI GGATC 1 cut(s) 36
BsrDI GCAATG 1 cut(s) 221
BssECI CCNNGG 1 cut(s) 57
BssMI GATC 1 cut(s) 28
BssT1I CCWWGG 1 cut(s) 57
BstAPI GCANNNNNTGC 1 cut(s) 76
BstC8I GCNNGC 1 cut(s) 204
BstDEI CTNAG 1 cut(s) 258
BstENI CCTNNNNNAGG 1 cut(s) 188
BstKTI GATC 1 cut(s) 31
BstMBI GATC 1 cut(s) 28
BstMWI GCNNNNNNNGC 1 cut(s) 76
BstV2I GAAGAC 1 cut(s) 29
BstX2I RGATCY 1 cut(s) 28
BstYI RGATCY 1 cut(s) 28
Cac8I GCNNGC 1 cut(s) 204
Cfr13I GGNCC 1 cut(s) 61
CviAII CATG 1 cut(s) 245
CviJI RGCY 4 cut(s) 49, 56, 202, 262
CviKI_1 RGCY 4 cut(s) 49, 56, 202, 262
DdeI CTNAG 1 cut(s) 258
DpnI GATC 1 cut(s) 30
DpnII GATC 1 cut(s) 28
Eco130I CCWWGG 1 cut(s) 57
Eco47I GGWCC 1 cut(s) 61
EcoNI CCTNNNNNAGG 1 cut(s) 188
EcoRI GAATTC 1 cut(s) 82
EcoT14I CCWWGG 1 cut(s) 57
ErhI CCWWGG 1 cut(s) 57
FaeI CATG 1 cut(s) 248
FaiI YATR 2 cut(s) 34, 246
FaqI GGGAC 1 cut(s) 113
FatI CATG 1 cut(s) 244
GsaI CCCAGC 1 cut(s) 96
Hin1II CATG 1 cut(s) 248
HindIII AAGCTT 1 cut(s) 200
Hpy166II GTNNAC 1 cut(s) 166
Hpy8I GTNNAC 1 cut(s) 166
HpyAV CCTTC 1 cut(s) 203
HpyCH4V TGCA 2 cut(s) 70, 206
HpyF10VI GCNNNNNNNGC 1 cut(s) 76
HpyF3I CTNAG 1 cut(s) 258
Hsp92II CATG 1 cut(s) 248
Kzo9I GATC 1 cut(s) 28
LmnI GCTCC 1 cut(s) 53
LpnPI CCDG 7 cut(s) 26, 31, 77, 78, 135, 144, 197
LweI GCATC 1 cut(s) 57
MalI GATC 1 cut(s) 30
MboI GATC 1 cut(s) 28
MboII GAAGA 1 cut(s) 29
MflI RGATCY 1 cut(s) 28
MluCI AATT 1 cut(s) 82
MnlI CCTC 2 cut(s) 141, 184
MseI TTAA 1 cut(s) 265
MwoI GCNNNNNNNGC 1 cut(s) 76
NdeII GATC 1 cut(s) 28
NlaIII CATG 1 cut(s) 248
NlaIV GGNNCC 1 cut(s) 55
PspFI CCCAGC 1 cut(s) 92
PspN4I GGNNCC 1 cut(s) 55
PspPI GGNCC 1 cut(s) 61
PsuI RGATCY 1 cut(s) 28
SaqAI TTAA 1 cut(s) 265
Sau3AI GATC 1 cut(s) 28
Sau96I GGNCC 1 cut(s) 61
SetI ASST 3 cut(s) 186, 204, 259
SfaNI GCATC 1 cut(s) 57
SinI GGWCC 1 cut(s) 61
Sse9I AATT 1 cut(s) 82
SspI AATATT 1 cut(s) 75
StyI CCWWGG 1 cut(s) 57
TasI AATT 1 cut(s) 82
Tru1I TTAA 1 cut(s) 265
Tru9I TTAA 1 cut(s) 265
TspDTI ATGAA 1 cut(s) 261
VpaK11BI GGWCC 1 cut(s) 61
XagI CCTNNNNNAGG 1 cut(s) 188
XapI RAATTY 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.