Rroxscaffold_7G00174890

mediator of RNA polymerase II transcription subunit

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
14588972 .. 14590670
1699 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00174890.1

Sequence Viewer

Length: 333 bp
ATGGAGCTGGACAATATGGCTAACTTGTCAGACAACTGCAATTTCCAGATTCCTATGGAGGTTATTAAGTTGATCGACGATGGAAAGAATCCTGATTTACTTACAAGGGATCTCATAAACAACTGCAATGCCAAAAATCAGATCACTAAAGGCAAAACTGATACCTTCAAGAGTTTACGAGAGCATCAACTGGAAGAACTTGACCAGGCATTTCCTGATGAAGTTGAATCATATAGAGAAATACGTCCTGCTGCTTCTGCTATAAGTTGCATTGCATTGATCACCCAATCTAGACTTTGCGCCCATCCTCGAAATGTTACACGAGTGTTTTAG

Protein Analysis

110

Amino Acids

12.52

Weight (kDa)

5.1

Isoelectric Point (pI)

18.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med10 PF09748 2 - 79 5e-24 Transcription factor subunit Med10 of Mediator complex
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 117
AgsI TTSAA 2 cut(s) 169, 227
AjnI CCWGG 1 cut(s) 204
AluBI AGCT 1 cut(s) 7
AluI AGCT 1 cut(s) 7
AlwI GGATC 1 cut(s) 117
ApeKI GCWGC 1 cut(s) 251
AspLEI GCGC 1 cut(s) 302
AsuHPI GGTGA 1 cut(s) 274
BauI CACGAG 1 cut(s) 321
BbvI GCAGC 1 cut(s) 238
BccI CCATC 2 cut(s) 74, 312
BciT130I CCWGG 1 cut(s) 206
BclI TGATCA 1 cut(s) 279
BfaI CTAG 1 cut(s) 291
BisI GCNGC 1 cut(s) 252
BlsI GCNGC 1 cut(s) 253
Bme1390I CCNGG 1 cut(s) 206
BmrFI CCNGG 1 cut(s) 206
BmsI GCATC 1 cut(s) 193
Bse1I ACTGG 1 cut(s) 195
Bse3DI GCAATG 2 cut(s) 133, 270
BseBI CCWGG 1 cut(s) 206
BseGI GGATG 1 cut(s) 304
BseMI GCAATG 2 cut(s) 133, 270
BseNI ACTGG 1 cut(s) 195
BseXI GCAGC 1 cut(s) 238
Bsp143I GATC 4 cut(s) 72, 109, 141, 279
BspPI GGATC 1 cut(s) 117
BsrDI GCAATG 2 cut(s) 133, 270
BsrI ACTGG 1 cut(s) 195
BssMI GATC 4 cut(s) 72, 109, 141, 279
BssSI CACGAG 1 cut(s) 321
Bst2BI CACGAG 1 cut(s) 321
Bst2UI CCWGG 1 cut(s) 206
BstF5I GGATG 1 cut(s) 304
BstHHI GCGC 1 cut(s) 302
BstKTI GATC 4 cut(s) 75, 112, 144, 282
BstMBI GATC 4 cut(s) 72, 109, 141, 279
BstMWI GCNNNNNNNGC 1 cut(s) 257
BstNI CCWGG 1 cut(s) 206
BstSCI CCNGG 1 cut(s) 204
BstV1I GCAGC 1 cut(s) 238
BstX2I RGATCY 1 cut(s) 109
BstYI RGATCY 1 cut(s) 109
BtsCI GGATG 1 cut(s) 304
CfoI GCGC 1 cut(s) 302
CviJI RGCY 2 cut(s) 7, 20
CviKI_1 RGCY 2 cut(s) 7, 20
DpnI GATC 4 cut(s) 74, 111, 143, 281
DpnII GATC 4 cut(s) 72, 109, 141, 279
EcoRII CCWGG 1 cut(s) 204
FaiI YATR 6 cut(s) 17, 56, 116, 232, 234, 263
FbaI TGATCA 1 cut(s) 279
Fnu4HI GCNGC 1 cut(s) 252
FokI GGATG 1 cut(s) 291
Fsp4HI GCNGC 1 cut(s) 252
FspBI CTAG 1 cut(s) 291
GlaI GCGC 1 cut(s) 301
GluI GCNGC 1 cut(s) 252
HhaI GCGC 1 cut(s) 302
Hin6I GCGC 1 cut(s) 300
HinP1I GCGC 1 cut(s) 300
HinfI GANTC 3 cut(s) 49, 88, 227
HphI GGTGA 1 cut(s) 274
Hpy166II GTNNAC 1 cut(s) 176
Hpy188I TCNGA 2 cut(s) 31, 141
Hpy188III TCNNGA 5 cut(s) 46, 92, 169, 215, 291
Hpy8I GTNNAC 1 cut(s) 176
Hpy99I CGWCG 1 cut(s) 80
HpyAV CCTTC 1 cut(s) 175
HpyCH4IV ACGT 1 cut(s) 244
HpyCH4V TGCA 4 cut(s) 39, 126, 270, 275
HpyF10VI GCNNNNNNNGC 1 cut(s) 257
HpySE526I ACGT 1 cut(s) 244
HspAI GCGC 1 cut(s) 300
Ksp22I TGATCA 1 cut(s) 279
Kzo9I GATC 4 cut(s) 72, 109, 141, 279
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 7 cut(s) 59, 105, 176, 191, 218, 228, 261
Lsp1109I GCAGC 1 cut(s) 238
LweI GCATC 1 cut(s) 193
MaeI CTAG 1 cut(s) 291
MaeII ACGT 1 cut(s) 244
MaeIII GTNAC 1 cut(s) 316
MalI GATC 4 cut(s) 74, 111, 143, 281
MboI GATC 4 cut(s) 72, 109, 141, 279
MboII GAAGA 1 cut(s) 206
MflI RGATCY 1 cut(s) 109
MluCI AATT 1 cut(s) 40
MnlI CCTC 2 cut(s) 52, 318
MseI TTAA 1 cut(s) 66
MspR9I CCNGG 1 cut(s) 206
MvaI CCWGG 1 cut(s) 206
MwoI GCNNNNNNNGC 1 cut(s) 257
NdeII GATC 4 cut(s) 72, 109, 141, 279
PfeI GAWTC 3 cut(s) 49, 88, 227
PkrI GCNGC 1 cut(s) 253
Psp6I CCWGG 1 cut(s) 204
PspGI CCWGG 1 cut(s) 204
PsuI RGATCY 1 cut(s) 109
SaqAI TTAA 1 cut(s) 66
SatI GCNGC 1 cut(s) 252
Sau3AI GATC 4 cut(s) 72, 109, 141, 279
ScrFI CCNGG 1 cut(s) 206
SetI ASST 4 cut(s) 9, 63, 167, 247
SfaNI GCATC 1 cut(s) 193
Sse9I AATT 1 cut(s) 40
SspMI CTAG 1 cut(s) 291
StyD4I CCNGG 1 cut(s) 204
TaiI ACGT 1 cut(s) 247
TaqI TCGA 2 cut(s) 75, 310
TasI AATT 1 cut(s) 40
TfiI GAWTC 3 cut(s) 49, 88, 227
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
TseI GCWGC 1 cut(s) 251
TspDTI ATGAA 1 cut(s) 234
XbaI TCTAGA 1 cut(s) 290
XspI CTAG 1 cut(s) 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.