RchiOBHm_Chr1g0326791

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0000825
Physical Location & Seq
Reverse (-)
15323099 .. 15326296
3198 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55636

Sequence Viewer

Length: 240 bp
ATGCGAACCGTTCTCGATGATTGGGTGACAACGGAGGCAGTTGGCTCTCAAGCTCGTGCTATTCTAAATCAAGGTCTTCTCCAATCTTATATGTTGCTCTTATTGTCGTGGGAGCATTGCTTATTCTTGCCTATTCACACAGTGGCAAAGGTGGACTTGGTAACATTAGAAGGGCTACTAGCAGGGTTCAAGGTGATTACTCATGCACAACAGAGGTCCAGCAAACAATTCATGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

8.93

Weight (kDa)

6.81

Isoelectric Point (pI)

37.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 142
AgsI TTSAA 1 cut(s) 190
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
AspS9I GGNCC 1 cut(s) 216
AsuHPI GGTGA 2 cut(s) 37, 205
AvaII GGWCC 1 cut(s) 216
BauI CACGAG 1 cut(s) 54
BbsI GAAGAC 1 cut(s) 68
BfaI CTAG 1 cut(s) 179
Bme18I GGWCC 1 cut(s) 216
BmgT120I GGNCC 1 cut(s) 216
BpiI GAAGAC 1 cut(s) 68
BpuEI CTTGAG 1 cut(s) 33
Bse3DI GCAATG 1 cut(s) 115
BseMI GCAATG 1 cut(s) 115
BsrDI GCAATG 1 cut(s) 115
BssSI CACGAG 1 cut(s) 54
Bst2BI CACGAG 1 cut(s) 54
Bst4CI ACNGT 2 cut(s) 10, 142
BstV2I GAAGAC 1 cut(s) 68
BtsIMutI CAGTG 1 cut(s) 147
Cfr13I GGNCC 1 cut(s) 216
CviAII CATG 2 cut(s) 203, 232
CviJI RGCY 3 cut(s) 45, 53, 175
CviKI_1 RGCY 3 cut(s) 45, 53, 175
DraIII CACNNNGTG 1 cut(s) 142
Eco47I GGWCC 1 cut(s) 216
FaeI CATG 2 cut(s) 206, 235
FaiI YATR 4 cut(s) 90, 92, 204, 233
FalI AAGNNNNNCTT 2 cut(s) 140, 172
FatI CATG 2 cut(s) 202, 231
FspBI CTAG 1 cut(s) 179
Hin1II CATG 2 cut(s) 206, 235
HphI GGTGA 2 cut(s) 37, 205
Hpy166II GTNNAC 1 cut(s) 154
Hpy188III TCNNGA 1 cut(s) 14
Hpy8I GTNNAC 1 cut(s) 154
HpyAV CCTTC 1 cut(s) 164
HpyCH4III ACNGT 2 cut(s) 10, 142
HpyCH4V TGCA 1 cut(s) 206
Hsp92II CATG 2 cut(s) 206, 235
LmnI GCTCC 1 cut(s) 112
LpnPI CCDG 2 cut(s) 168, 232
MaeI CTAG 1 cut(s) 179
MaeIII GTNAC 2 cut(s) 25, 160
MboII GAAGA 1 cut(s) 68
MluCI AATT 1 cut(s) 227
MnlI CCTC 2 cut(s) 28, 207
NlaIII CATG 2 cut(s) 206, 235
NmuCI GTSAC 1 cut(s) 25
PspPI GGNCC 1 cut(s) 216
Sau96I GGNCC 1 cut(s) 216
SetI ASST 5 cut(s) 55, 76, 153, 195, 218
SinI GGWCC 1 cut(s) 216
SmlI CTYRAG 1 cut(s) 48
SmoI CTYRAG 1 cut(s) 48
Sse9I AATT 1 cut(s) 227
SspMI CTAG 1 cut(s) 179
TaaI ACNGT 2 cut(s) 10, 142
TaqI TCGA 1 cut(s) 15
TasI AATT 1 cut(s) 227
TscAI CASTG 1 cut(s) 147
TseFI GTSAC 1 cut(s) 25
Tsp45I GTSAC 1 cut(s) 25
TspDTI ATGAA 1 cut(s) 220
TspGWI ACGGA 1 cut(s) 47
TspRI CASTG 1 cut(s) 147
VpaK11BI GGWCC 1 cut(s) 216
XspI CTAG 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.