RchiOBHm_Chr6g0265491

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
21385928 .. 21389136
3209 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23810

Sequence Viewer

Length: 126 bp
ATGCAAACCGTTCTCGGCGATTGGGTGATAACGGAGGCAGTTGGCTCTCAGGCTCGTACTATTCTAAATCAAGGGAGCATTTCTTATTCTTGCCTATTCACACAGTGGCAAAGGTGGACTTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

41

Amino Acids

4.76

Weight (kDa)

5.82

Isoelectric Point (pI)

33.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 105
AfaI GTAC 1 cut(s) 58
AsuHPI GGTGA 1 cut(s) 37
BseMII CTCAG 1 cut(s) 62
BspCNI CTCAG 1 cut(s) 61
Bst4CI ACNGT 2 cut(s) 10, 105
BstDEI CTNAG 1 cut(s) 48
BtsIMutI CAGTG 1 cut(s) 110
Csp6I GTAC 1 cut(s) 57
CviJI RGCY 2 cut(s) 45, 53
CviKI_1 RGCY 2 cut(s) 45, 53
CviQI GTAC 1 cut(s) 57
DdeI CTNAG 1 cut(s) 48
DraIII CACNNNGTG 1 cut(s) 105
FalI AAGNNNNNCTT 1 cut(s) 103
HphI GGTGA 1 cut(s) 37
Hpy166II GTNNAC 1 cut(s) 117
Hpy8I GTNNAC 1 cut(s) 117
HpyCH4III ACNGT 2 cut(s) 10, 105
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 48
LmnI GCTCC 1 cut(s) 75
LpnPI CCDG 1 cut(s) 35
MnlI CCTC 1 cut(s) 28
RsaI GTAC 1 cut(s) 58
RsaNI GTAC 1 cut(s) 57
SetI ASST 1 cut(s) 116
SgeI CNNG 5 cut(s) 26, 62, 66, 83, 102
TaaI ACNGT 2 cut(s) 10, 105
TscAI CASTG 1 cut(s) 110
TspGWI ACGGA 1 cut(s) 47
TspRI CASTG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.