Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000007

Orthogroup ID

OG0000825

Physical Location & Seq

Genomic Coordinates Reverse (-)

2113554 .. 2113997

Gene Structure 444 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_7G00158790.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 354 bp

ATGGCAGGTGATTACTCATGCACAGCGGAGGTCCAGCAAGCAATTCCTGTTTTGAAGAAAGCATATGGTGACAGCATGCATAAGGTTTTGCATGTTGGCCCTGATACTTGTACAGTGGTTTCTAAATTGTGTAGTGAGGAGGAAATTGAAGCCTGGGGTGTGGATCCGTACGATGTAGAGGATGCTGATAGAAGTTGCAAAGCTCTTGTGCGCAAAGGCATAGTGCGTGTTGATGATATCAAGTATCCACTTCCATACAGGCCAAAATCATTTTCTGTTGTCATTGTTTCCGATTCTTTGGATCATTTTTCTGAAAGATACCTCGATCAACAAGACCCTTCCAGATCTGGCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pentapeptide

Protein Analysis

117

Amino Acids

13.05

Weight (kDa)

4.94

Isoelectric Point (pI)

54.76

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000825)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G49720 AT3G49720 AT3G49720 AT5G65810
fragaria_vesca	FvH4_1g18360 FvH4_2g02740 FvH4_2g02740 FvH4_2g02740 FvH4_2g02740
malus_domestica	MD02G1190800.v1.1 MD05G1110700.v1.1 MD08G1076600.v1.1 MD10G1114200.v1.1 MD15G1063900.v1.1 MD15G1301800.v1.1
prunus_persica	Prupe.1G417900_v2.0.a1 Prupe.1G417900_v2.0.a1 Prupe.1G417900_v2.0.a1 Prupe.1G417900_v2.0.a1 Prupe.1G417900_v2.0.a1 Prupe.1G417900_v2.0.a1 Prupe.1G417900_v2.0.a1 Prupe.6G215300_v2.0.a1 Prupe.8G155700_v2.0.a1
pyrus_communis	pycom02g15510 pycom05g10670 pycom10g09860 pycom15g06060 pycom15g26460
rosa_chinensis	RchiOBHm_Chr1g0326791 RchiOBHm_Chr2g0109071 RchiOBHm_Chr6g0247201 RchiOBHm_Chr6g0265491
rosa_laevigata	RLG00000007597 RLG00000010502 RLG00000015215 RLG00000017695 RLG00000017703 RLG00000019872 RLG00000031939 RLG00000032659
rosa_multiflora	Rmu_sc0003410.1_g000016 Rmu_sc0003725.1_g000002 Rmu_sc0004368.1_g000001
rosa_roxburghii	Rroxscaffold_180G00433610 Rroxscaffold_2G00134600 Rroxscaffold_3G00255070 Rroxscaffold_7G00158770 Rroxscaffold_7G00158790 Rroxscaffold_7G00214250
rosa_rugosa	Rorug02G0157000 Rorug05G0524000 Rorug05G0524000 Rorug05G0524000 Rorug06G0378100
rosa_samantha	Rh2AG207800 Rh2BG219100 Rh2CG211200 Rh2DG214200 Rh6AG492100 Rh6BG033200 Rh6BG501700 Rh6DG492800
rosa_wichuraiana	Rw0G004060 Rw1G004210 Rw2G016500 Rw6G003300 Rw6G042820

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	212
AciI	CCGC	1 cut(s)	26
AclWI	GGATC	3 cut(s)	158, 171, 309
AfaI	GTAC	2 cut(s)	112, 170
AgsI	TTSAA	2 cut(s)	55, 149
AjnI	CCWGG	1 cut(s)	152
AjuI	GAANNNNNNNTTGG	2 cut(s)	256, 288
AluBI	AGCT	1 cut(s)	203
AluI	AGCT	1 cut(s)	203
AlwI	GGATC	3 cut(s)	158, 171, 309
AoxI	GGCC	2 cut(s)	97, 260
AspLEI	GCGC	1 cut(s)	213
AspS9I	GGNCC	2 cut(s)	31, 98
AsuHPI	GGTGA	2 cut(s)	20, 80
AvaII	GGWCC	1 cut(s)	31
BamHI	GGATCC	1 cut(s)	163
BciT130I	CCWGG	1 cut(s)	154
BciVI	GTATCC	1 cut(s)	255
BfaI	CTAG	1 cut(s)	352
BfuI	GTATCC	1 cut(s)	255
BglII	AGATCT	1 cut(s)	344
Bme1390I	CCNGG	1 cut(s)	154
Bme18I	GGWCC	1 cut(s)	31
BmgT120I	GGNCC	2 cut(s)	31, 98
BmiI	GGNNCC	1 cut(s)	165
BmrFI	CCNGG	1 cut(s)	154
BmsI	GCATC	1 cut(s)	172
BsaJI	CCNNGG	1 cut(s)	153
BseBI	CCWGG	1 cut(s)	154
BseDI	CCNNGG	1 cut(s)	153
BseGI	GGATG	1 cut(s)	187
BseRI	GAGGAG	1 cut(s)	152
BshFI	GGCC	2 cut(s)	99, 262
BsiWI	CGTACG	1 cut(s)	168
BsnI	GGCC	2 cut(s)	99, 262
Bsp1407I	TGTACA	1 cut(s)	110
Bsp143I	GATC	4 cut(s)	163, 301, 325, 344
BspACI	CCGC	1 cut(s)	26
BspANI	GGCC	2 cut(s)	99, 262
BspLI	GGNNCC	1 cut(s)	165
BspPI	GGATC	3 cut(s)	158, 171, 309
BsrGI	TGTACA	1 cut(s)	110
BssECI	CCNNGG	1 cut(s)	153
BssMI	GATC	4 cut(s)	163, 301, 325, 344
Bst2UI	CCWGG	1 cut(s)	154
Bst4CI	ACNGT	1 cut(s)	115
BstAUI	TGTACA	1 cut(s)	110
BstC8I	GCNNGC	2 cut(s)	39, 77
BstF5I	GGATG	1 cut(s)	187
BstHHI	GCGC	1 cut(s)	213
BstKTI	GATC	4 cut(s)	166, 304, 328, 347
BstMBI	GATC	4 cut(s)	163, 301, 325, 344
BstNI	CCWGG	1 cut(s)	154
BstNSI	RCATGY	2 cut(s)	79, 95
BstSCI	CCNGG	1 cut(s)	152
BstX2I	RGATCY	2 cut(s)	163, 344
BstYI	RGATCY	2 cut(s)	163, 344
BsuI	GTATCC	1 cut(s)	255
BsuRI	GGCC	2 cut(s)	99, 262
BtsCI	GGATG	1 cut(s)	187
BtsIMutI	CAGTG	1 cut(s)	120
Cac8I	GCNNGC	2 cut(s)	39, 77
CfoI	GCGC	1 cut(s)	213
Cfr13I	GGNCC	2 cut(s)	31, 98
Csp6I	GTAC	2 cut(s)	111, 169
CviAII	CATG	3 cut(s)	18, 76, 92
CviJI	RGCY	5 cut(s)	99, 152, 203, 262, 351
CviKI_1	RGCY	5 cut(s)	99, 152, 203, 262, 351
CviQI	GTAC	2 cut(s)	111, 169
DpnI	GATC	4 cut(s)	165, 303, 327, 346
DpnII	GATC	4 cut(s)	163, 301, 325, 344
Eco32I	GATATC	1 cut(s)	238
Eco47I	GGWCC	1 cut(s)	31
EcoRII	CCWGG	1 cut(s)	152
EcoRV	GATATC	1 cut(s)	238
EcoT22I	ATGCAT	1 cut(s)	81
FaeI	CATG	3 cut(s)	21, 79, 95
FaiI	YATR	8 cut(s)	19, 64, 66, 77, 81, 93, 221, 256
FatI	CATG	3 cut(s)	17, 75, 91
FauNDI	CATATG	1 cut(s)	64
FokI	GGATG	1 cut(s)	194
FspBI	CTAG	1 cut(s)	352
FspI	TGCGCA	1 cut(s)	212
GlaI	GCGC	1 cut(s)	212
HaeIII	GGCC	2 cut(s)	99, 262
HhaI	GCGC	1 cut(s)	213
Hin1II	CATG	3 cut(s)	21, 79, 95
Hin6I	GCGC	1 cut(s)	211
HinP1I	GCGC	1 cut(s)	211
HinfI	GANTC	1 cut(s)	293
HphI	GGTGA	2 cut(s)	20, 80
Hpy188I	TCNGA	2 cut(s)	292, 313
Hpy188III	TCNNGA	1 cut(s)	342
HpyAV	CCTTC	1 cut(s)	348
HpyCH4III	ACNGT	1 cut(s)	115
HpyCH4V	TGCA	4 cut(s)	21, 79, 91, 198
Hsp92II	CATG	3 cut(s)	21, 79, 95
HspAI	GCGC	1 cut(s)	211
Kzo9I	GATC	4 cut(s)	163, 301, 325, 344
LpnPI	CCDG	7 cut(s)	47, 60, 114, 139, 166, 244, 333
LweI	GCATC	1 cut(s)	172
MaeI	CTAG	1 cut(s)	352
MaeIII	GTNAC	1 cut(s)	68
MalI	GATC	4 cut(s)	165, 303, 327, 346
MboI	GATC	4 cut(s)	163, 301, 325, 344
MboII	GAAGA	1 cut(s)	67
MflI	RGATCY	2 cut(s)	163, 344
MluCI	AATT	3 cut(s)	42, 125, 144
MnlI	CCTC	5 cut(s)	22, 130, 133, 172, 332
Mph1103I	ATGCAT	1 cut(s)	81
MspA1I	CMGCKG	1 cut(s)	26
MspR9I	CCNGG	1 cut(s)	154
MvaI	CCWGG	1 cut(s)	154
NdeI	CATATG	1 cut(s)	64
NdeII	GATC	4 cut(s)	163, 301, 325, 344
NlaIII	CATG	3 cut(s)	21, 79, 95
NlaIV	GGNNCC	1 cut(s)	165
NmuCI	GTSAC	1 cut(s)	68
NsbI	TGCGCA	1 cut(s)	212
NsiI	ATGCAT	1 cut(s)	81
NspI	RCATGY	2 cut(s)	79, 95
PaeI	GCATGC	1 cut(s)	79
PfeI	GAWTC	1 cut(s)	293
Pfl23II	CGTACG	1 cut(s)	168
Psp6I	CCWGG	1 cut(s)	152
PspGI	CCWGG	1 cut(s)	152
PspLI	CGTACG	1 cut(s)	168
PspN4I	GGNNCC	1 cut(s)	165
PspPI	GGNCC	2 cut(s)	31, 98
PsuI	RGATCY	2 cut(s)	163, 344
RsaI	GTAC	2 cut(s)	112, 170
RsaNI	GTAC	2 cut(s)	111, 169
Sau3AI	GATC	4 cut(s)	163, 301, 325, 344
Sau96I	GGNCC	2 cut(s)	31, 98
ScrFI	CCNGG	1 cut(s)	154
SetI	ASST	5 cut(s)	10, 33, 87, 205, 324
SfaNI	GCATC	1 cut(s)	172
SinI	GGWCC	1 cut(s)	31
SphI	GCATGC	1 cut(s)	79
Sse9I	AATT	3 cut(s)	42, 125, 144
SsiI	CCGC	1 cut(s)	26
SspMI	CTAG	1 cut(s)	352
StyD4I	CCNGG	1 cut(s)	152
TaaI	ACNGT	1 cut(s)	115
TaqI	TCGA	1 cut(s)	324
TasI	AATT	3 cut(s)	42, 125, 144
TatI	WGTACW	1 cut(s)	110
TfiI	GAWTC	1 cut(s)	293
TscAI	CASTG	1 cut(s)	120
TseFI	GTSAC	1 cut(s)	68
Tsp45I	GTSAC	1 cut(s)	68
TspGWI	ACGGA	1 cut(s)	156
TspRI	CASTG	1 cut(s)	120
VpaK11BI	GGWCC	1 cut(s)	31
XceI	RCATGY	2 cut(s)	79, 95
XspI	CTAG	1 cut(s)	352
Zsp2I	ATGCAT	1 cut(s)	81

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.