RchiOBHm_Chr1g0381551

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0001309
Physical Location & Seq
Forward (+)
66874614 .. 66875105
492 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ60465

Sequence Viewer

Length: 174 bp
ATGAGGCTTGACCTTGAATGGGAGTTAAACTTTGAAGATTTTTGGGTTGTGCACAGTAAGACTAGGATACCAGTTCATCACCGAGTACTCCCTCTAGTTTCCAGAAAACTGCTGCGAGGGAGTTCAAACCCATACTGCAAATCAGACTTGTTGAAGGTAAATTCAAAGTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.84

Weight (kDa)

9.74

Isoelectric Point (pI)

13.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 160
AfaI GTAC 1 cut(s) 87
AfiI CCNNNNNNNGG 1 cut(s) 19
AgsI TTSAA 5 cut(s) 17, 35, 126, 154, 165
Alw21I GWGCWC 1 cut(s) 54
Alw44I GTGCAC 1 cut(s) 50
ApaLI GTGCAC 1 cut(s) 50
ApeKI GCWGC 1 cut(s) 112
ApoI RAATTY 1 cut(s) 160
AsuHPI GGTGA 1 cut(s) 71
BaeGI GKGCMC 1 cut(s) 54
Bbv12I GWGCWC 1 cut(s) 54
BbvI GCAGC 1 cut(s) 99
BciVI GTATCC 1 cut(s) 60
BfaI CTAG 3 cut(s) 63, 95, 172
BfuI GTATCC 1 cut(s) 60
BisI GCNGC 1 cut(s) 113
BlsI GCNGC 1 cut(s) 114
BmcAI AGTACT 1 cut(s) 87
Bsc4I CCNNNNNNNGG 1 cut(s) 19
Bse1I ACTGG 1 cut(s) 71
BseLI CCNNNNNNNGG 1 cut(s) 19
BseNI ACTGG 1 cut(s) 71
BseSI GKGCMC 1 cut(s) 54
BseXI GCAGC 1 cut(s) 99
BsiHKAI GWGCWC 1 cut(s) 54
BslI CCNNNNNNNGG 1 cut(s) 19
Bsp1286I GDGCHC 1 cut(s) 54
BsrI ACTGG 1 cut(s) 71
Bst4CI ACNGT 1 cut(s) 56
BstSLI GKGCMC 1 cut(s) 54
BstV1I GCAGC 1 cut(s) 99
BsuI GTATCC 1 cut(s) 60
Csp6I GTAC 1 cut(s) 86
CviJI RGCY 1 cut(s) 7
CviKI_1 RGCY 1 cut(s) 7
CviQI GTAC 1 cut(s) 86
FaiI YATR 1 cut(s) 133
Fnu4HI GCNGC 1 cut(s) 113
Fsp4HI GCNGC 1 cut(s) 113
FspBI CTAG 3 cut(s) 63, 95, 172
GluI GCNGC 1 cut(s) 113
HphI GGTGA 1 cut(s) 71
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 1 cut(s) 145
Hpy188III TCNNGA 1 cut(s) 102
Hpy8I GTNNAC 1 cut(s) 52
HpyAV CCTTC 1 cut(s) 148
HpyCH4III ACNGT 1 cut(s) 56
HpyCH4V TGCA 2 cut(s) 52, 138
LpnPI CCDG 2 cut(s) 84, 115
Lsp1109I GCAGC 1 cut(s) 99
MaeI CTAG 3 cut(s) 63, 95, 172
MboII GAAGA 1 cut(s) 47
MhlI GDGCHC 1 cut(s) 54
MluCI AATT 1 cut(s) 160
MnlI CCTC 2 cut(s) 102, 110
MseI TTAA 1 cut(s) 26
PkrI GCNGC 1 cut(s) 114
RsaI GTAC 1 cut(s) 87
RsaNI GTAC 1 cut(s) 86
SaqAI TTAA 1 cut(s) 26
SatI GCNGC 1 cut(s) 113
ScaI AGTACT 1 cut(s) 87
SduI GDGCHC 1 cut(s) 54
SetI ASST 2 cut(s) 15, 159
SgeI CNNG 9 cut(s) 20, 26, 75, 83, 95, 107, 114, 128, 160
Sse9I AATT 1 cut(s) 160
SspMI CTAG 3 cut(s) 63, 95, 172
TaaI ACNGT 1 cut(s) 56
TasI AATT 1 cut(s) 160
TatI WGTACW 1 cut(s) 85
Tru1I TTAA 1 cut(s) 26
Tru9I TTAA 1 cut(s) 26
TseI GCWGC 1 cut(s) 112
TspDTI ATGAA 1 cut(s) 65
VneI GTGCAC 1 cut(s) 50
XapI RAATTY 1 cut(s) 160
XspI CTAG 3 cut(s) 63, 95, 172
ZrmI AGTACT 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.