Rroxscaffold_1G00024690

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0001309
Physical Location & Seq
Forward (+)
30706797 .. 30710173
3377 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00024690.1

Sequence Viewer

Length: 159 bp
ATGGCGGCAGCAAAGTTGCTTGCTCGTATACTCAGTAGGGCAAGAAGGGAACCAATCAAGACGCCATGCTTGTTTGGAAGGTTTGGTAATTCATATGGTATTGCGGGTAGAAGTGAGAAGGGAGCAAGGGTAGAAGCTTTGGGAGCATCGGAAAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.6

Weight (kDa)

11.25

Isoelectric Point (pI)

39.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 28
AciI CCGC 2 cut(s) 5, 104
AcyI GRCGYC 1 cut(s) 62
AluBI AGCT 1 cut(s) 137
AluI AGCT 1 cut(s) 137
ApeKI GCWGC 1 cut(s) 8
BbvI GCAGC 1 cut(s) 20
BisI GCNGC 2 cut(s) 6, 9
BlsI GCNGC 2 cut(s) 7, 10
BmiI GGNNCC 1 cut(s) 51
BmsI GCATC 1 cut(s) 155
BsaHI GRCGYC 1 cut(s) 62
BsaXI ACNNNNNCTCC 2 cut(s) 114, 144
BseMII CTCAG 1 cut(s) 46
BseXI GCAGC 1 cut(s) 20
BspACI CCGC 2 cut(s) 5, 104
BspCNI CTCAG 1 cut(s) 45
BspLI GGNNCC 1 cut(s) 51
BssNAI GTATAC 1 cut(s) 29
BssNI GRCGYC 1 cut(s) 62
Bst1107I GTATAC 1 cut(s) 29
BstACI GRCGYC 1 cut(s) 62
BstC8I GCNNGC 1 cut(s) 21
BstDEI CTNAG 1 cut(s) 32
BstMWI GCNNNNNNNGC 1 cut(s) 143
BstV1I GCAGC 1 cut(s) 20
BstZ17I GTATAC 1 cut(s) 29
Cac8I GCNNGC 1 cut(s) 21
CseI GACGC 1 cut(s) 70
CviAII CATG 1 cut(s) 66
CviJI RGCY 1 cut(s) 137
CviKI_1 RGCY 1 cut(s) 137
DdeI CTNAG 1 cut(s) 32
FaeI CATG 1 cut(s) 69
FaiI YATR 4 cut(s) 29, 67, 94, 96
FatI CATG 1 cut(s) 65
FauI CCCGC 1 cut(s) 97
FauNDI CATATG 1 cut(s) 94
FblI GTMKAC 1 cut(s) 28
Fnu4HI GCNGC 2 cut(s) 6, 9
Fsp4HI GCNGC 2 cut(s) 6, 9
GluI GCNGC 2 cut(s) 6, 9
HgaI GACGC 1 cut(s) 70
Hin1I GRCGYC 1 cut(s) 62
Hin1II CATG 1 cut(s) 69
HindIII AAGCTT 1 cut(s) 135
Hpy166II GTNNAC 1 cut(s) 29
Hpy188I TCNGA 1 cut(s) 151
Hpy188III TCNNGA 1 cut(s) 58
Hpy8I GTNNAC 1 cut(s) 29
HpyAV CCTTC 3 cut(s) 39, 72, 112
HpyF10VI GCNNNNNNNGC 1 cut(s) 143
HpyF3I CTNAG 1 cut(s) 32
Hsp92I GRCGYC 1 cut(s) 62
Hsp92II CATG 1 cut(s) 69
LmnI GCTCC 2 cut(s) 122, 143
Lsp1109I GCAGC 1 cut(s) 20
LweI GCATC 1 cut(s) 155
MluCI AATT 1 cut(s) 88
MwoI GCNNNNNNNGC 1 cut(s) 143
NdeI CATATG 1 cut(s) 94
NlaIII CATG 1 cut(s) 69
NlaIV GGNNCC 1 cut(s) 51
PkrI GCNGC 2 cut(s) 7, 10
PspN4I GGNNCC 1 cut(s) 51
SatI GCNGC 2 cut(s) 6, 9
SetI ASST 2 cut(s) 83, 139
SfaNI GCATC 1 cut(s) 155
SgeI CNNG 8 cut(s) 32, 36, 54, 70, 78, 82, 117, 138
Sse9I AATT 1 cut(s) 88
SsiI CCGC 2 cut(s) 5, 104
TasI AATT 1 cut(s) 88
TauI GCSGC 1 cut(s) 8
TseI GCWGC 1 cut(s) 8
TspDTI ATGAA 1 cut(s) 81
XmiI GTMKAC 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.