RchiOBHm_Chr5g0042561

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0001283
Physical Location & Seq
Forward (+)
37419672 .. 37423902
4231 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32095

Sequence Viewer

Length: 156 bp
ATGGTAGACTTAGCAGGAAAAGATGGCATTGCGAAGGTTGGGTGTCAGGAAGTGTTTATATGCAATAAAACAAGGTTTTGTTCCAATGAGGCCATGAAAACAGCCAAGCTTGCAAAGCTAGACTCCTTAAGTAAATTTTTGGATGTATATTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.6

Weight (kDa)

8.42

Isoelectric Point (pI)

6.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 6
AcsI RAATTY 1 cut(s) 134
AflII CTTAAG 1 cut(s) 127
AluBI AGCT 2 cut(s) 109, 118
AluI AGCT 2 cut(s) 109, 118
AoxI GGCC 1 cut(s) 90
ApoI RAATTY 1 cut(s) 134
BccI CCATC 1 cut(s) 17
BfaI CTAG 2 cut(s) 119, 154
BfrI CTTAAG 1 cut(s) 127
Bse3DI GCAATG 1 cut(s) 27
BseGI GGATG 1 cut(s) 148
BseMI GCAATG 1 cut(s) 27
BshFI GGCC 1 cut(s) 92
BsnI GGCC 1 cut(s) 92
BspANI GGCC 1 cut(s) 92
BspTI CTTAAG 1 cut(s) 127
BsrDI GCAATG 1 cut(s) 27
BstAFI CTTAAG 1 cut(s) 127
BstC8I GCNNGC 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 10
BstF5I GGATG 1 cut(s) 148
BstMWI GCNNNNNNNGC 2 cut(s) 110, 115
BsuRI GGCC 1 cut(s) 92
BtsCI GGATG 1 cut(s) 148
Cac8I GCNNGC 1 cut(s) 111
CviAII CATG 1 cut(s) 94
CviJI RGCY 4 cut(s) 92, 104, 109, 118
CviKI_1 RGCY 4 cut(s) 92, 104, 109, 118
DdeI CTNAG 1 cut(s) 10
FaeI CATG 1 cut(s) 97
FaiI YATR 4 cut(s) 59, 61, 95, 148
FatI CATG 1 cut(s) 93
FblI GTMKAC 1 cut(s) 6
FspBI CTAG 2 cut(s) 119, 154
HaeIII GGCC 1 cut(s) 92
Hin1II CATG 1 cut(s) 97
HindIII AAGCTT 1 cut(s) 107
HinfI GANTC 1 cut(s) 122
Hpy166II GTNNAC 1 cut(s) 7
Hpy188III TCNNGA 1 cut(s) 47
Hpy8I GTNNAC 1 cut(s) 7
HpyAV CCTTC 1 cut(s) 28
HpyCH4V TGCA 2 cut(s) 63, 113
HpyF10VI GCNNNNNNNGC 2 cut(s) 110, 115
HpyF3I CTNAG 1 cut(s) 10
Hsp92II CATG 1 cut(s) 97
LpnPI CCDG 1 cut(s) 32
MaeI CTAG 2 cut(s) 119, 154
MluCI AATT 1 cut(s) 134
MlyI GAGTC 1 cut(s) 116
MnlI CCTC 1 cut(s) 82
MseI TTAA 1 cut(s) 128
MspCI CTTAAG 1 cut(s) 127
MwoI GCNNNNNNNGC 2 cut(s) 110, 115
NlaIII CATG 1 cut(s) 97
PleI GAGTC 1 cut(s) 116
PpsI GAGTC 1 cut(s) 116
SaqAI TTAA 1 cut(s) 128
SchI GAGTC 1 cut(s) 116
SetI ASST 4 cut(s) 39, 77, 111, 120
SgeI CNNG 7 cut(s) 27, 59, 84, 106, 118, 122, 131
SmlI CTYRAG 1 cut(s) 127
SmoI CTYRAG 1 cut(s) 127
Sse9I AATT 1 cut(s) 134
SspMI CTAG 2 cut(s) 119, 154
TasI AATT 1 cut(s) 134
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
TspDTI ATGAA 1 cut(s) 110
Vha464I CTTAAG 1 cut(s) 127
XapI RAATTY 1 cut(s) 134
XmiI GTMKAC 1 cut(s) 6
XspI CTAG 2 cut(s) 119, 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.