Rmu_co8249761.1_g000001

2-dehydro-3-deoxyphosphooctonate aldolase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8249761.1
Physical Location & Seq
Reverse (-)
1 .. 787
787 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8249761.1_g000001.1.cds

Sequence Viewer

Length: 286 bp
atccttgagaaggttaaaatagcttatgacctccctatagtcacagatgtacacgaatctatacagtgcgaagaagttggcaaagttgcagatatcattcagattcctgcatttttatgccgtcagacagatcttctagttgcagcagccaagactggaaagattgtcaatattaagaagggtcaattctgtgctccttctgtcatggtaaattctgctgagaagattagactggcaggaaatccaaatgtgatggtttgtgagaggggaactatgttcggttata

Protein Analysis

95

Amino Acids

10.36

Weight (kDa)

7.84

Isoelectric Point (pI)

15.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 211
AfaI GTAC 1 cut(s) 51
AfiI CCNNNNNNNGG 1 cut(s) 10
AluBI AGCT 1 cut(s) 23
AluI AGCT 1 cut(s) 23
Alw21I GWGCWC 1 cut(s) 196
ApeKI GCWGC 2 cut(s) 143, 146
ApoI RAATTY 1 cut(s) 211
Bbv12I GWGCWC 1 cut(s) 196
BbvI GCAGC 2 cut(s) 155, 158
BccI CCATC 1 cut(s) 247
BceAI ACGGC 1 cut(s) 105
BfaI CTAG 1 cut(s) 137
BfmI CTRYAG 1 cut(s) 36
BglII AGATCT 1 cut(s) 130
BisI GCNGC 2 cut(s) 144, 147
BlsI GCNGC 2 cut(s) 145, 148
BpuEI CTTGAG 1 cut(s) 26
Bsc4I CCNNNNNNNGG 1 cut(s) 10
Bse1I ACTGG 2 cut(s) 160, 237
BseLI CCNNNNNNNGG 1 cut(s) 10
BseMII CTCAG 1 cut(s) 210
BseNI ACTGG 2 cut(s) 160, 237
BseXI GCAGC 2 cut(s) 155, 158
BsiHKAI GWGCWC 1 cut(s) 196
BslI CCNNNNNNNGG 1 cut(s) 10
Bsp1286I GDGCHC 1 cut(s) 196
Bsp1407I TGTACA 1 cut(s) 49
Bsp143I GATC 1 cut(s) 130
BspCNI CTCAG 1 cut(s) 211
BsrGI TGTACA 1 cut(s) 49
BsrI ACTGG 2 cut(s) 160, 237
BssMI GATC 1 cut(s) 130
Bst4CI ACNGT 1 cut(s) 66
BstAUI TGTACA 1 cut(s) 49
BstDEI CTNAG 1 cut(s) 219
BstENI CCTNNNNNAGG 1 cut(s) 8
BstKTI GATC 1 cut(s) 133
BstMBI GATC 1 cut(s) 130
BstSFI CTRYAG 1 cut(s) 36
BstV1I GCAGC 2 cut(s) 155, 158
BstX2I RGATCY 1 cut(s) 130
BstYI RGATCY 1 cut(s) 130
BtsIMutI CAGTG 1 cut(s) 71
Csp6I GTAC 1 cut(s) 50
CviAII CATG 1 cut(s) 205
CviJI RGCY 2 cut(s) 23, 149
CviKI_1 RGCY 2 cut(s) 23, 149
CviQI GTAC 1 cut(s) 50
DdeI CTNAG 1 cut(s) 219
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
Eco32I GATATC 1 cut(s) 94
EcoNI CCTNNNNNAGG 1 cut(s) 8
EcoRV GATATC 1 cut(s) 94
FaeI CATG 1 cut(s) 208
FaiI YATR 7 cut(s) 27, 38, 62, 118, 206, 275, 285
FatI CATG 1 cut(s) 204
Fnu4HI GCNGC 2 cut(s) 144, 147
Fsp4HI GCNGC 2 cut(s) 144, 147
FspBI CTAG 1 cut(s) 137
GluI GCNGC 2 cut(s) 144, 147
Hin1II CATG 1 cut(s) 208
HinfI GANTC 2 cut(s) 56, 103
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 2 cut(s) 102, 126
Hpy8I GTNNAC 1 cut(s) 52
HpyAV CCTTC 3 cut(s) 4, 172, 207
HpyCH4III ACNGT 1 cut(s) 66
HpyCH4V TGCA 3 cut(s) 89, 110, 143
HpyF3I CTNAG 1 cut(s) 219
Hsp92II CATG 1 cut(s) 208
Kzo9I GATC 1 cut(s) 130
LmnI GCTCC 1 cut(s) 199
LpnPI CCDG 4 cut(s) 120, 141, 218, 222
Lsp1109I GCAGC 2 cut(s) 155, 158
MaeI CTAG 1 cut(s) 137
MaeIII GTNAC 1 cut(s) 40
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MboII GAAGA 3 cut(s) 83, 125, 235
MflI RGATCY 1 cut(s) 130
MhlI GDGCHC 1 cut(s) 196
MluCI AATT 2 cut(s) 185, 211
MnlI CCTC 2 cut(s) 41, 258
MseI TTAA 2 cut(s) 15, 174
MslI CAYNNNNRTG 1 cut(s) 115
NdeII GATC 1 cut(s) 130
NlaIII CATG 1 cut(s) 208
NmuCI GTSAC 1 cut(s) 40
PfeI GAWTC 2 cut(s) 56, 103
PkrI GCNGC 2 cut(s) 145, 148
PsuI RGATCY 1 cut(s) 130
RsaI GTAC 1 cut(s) 51
RsaNI GTAC 1 cut(s) 50
RseI CAYNNNNRTG 1 cut(s) 115
SaqAI TTAA 2 cut(s) 15, 174
SatI GCNGC 2 cut(s) 144, 147
Sau3AI GATC 1 cut(s) 130
SduI GDGCHC 1 cut(s) 196
SetI ASST 3 cut(s) 15, 25, 33
SfcI CTRYAG 1 cut(s) 36
SgeI CNNG 9 cut(s) 17, 65, 119, 149, 163, 168, 217, 245, 249
SmiMI CAYNNNNRTG 1 cut(s) 115
SmlI CTYRAG 1 cut(s) 5
SmoI CTYRAG 1 cut(s) 5
Sse9I AATT 2 cut(s) 185, 211
SspI AATATT 1 cut(s) 172
SspMI CTAG 1 cut(s) 137
TaaI ACNGT 1 cut(s) 66
TasI AATT 2 cut(s) 185, 211
TatI WGTACW 1 cut(s) 49
TfiI GAWTC 2 cut(s) 56, 103
Tru1I TTAA 2 cut(s) 15, 174
Tru9I TTAA 2 cut(s) 15, 174
TscAI CASTG 1 cut(s) 71
TseFI GTSAC 1 cut(s) 40
TseI GCWGC 2 cut(s) 143, 146
Tsp45I GTSAC 1 cut(s) 40
TspRI CASTG 1 cut(s) 71
XagI CCTNNNNNAGG 1 cut(s) 8
XapI RAATTY 1 cut(s) 211
XspI CTAG 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.