Rh4BG085300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
14715862 .. 14717120
1259 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG085300.1

Sequence Viewer

Length: 213 bp
ATGGACGTGGAAAGTATCGCTCTCTTTGCTGTCCAAGAACACAATAATCGACAGAATGGTGTGCTTGAGTTTCTTTGCTGCTGTGAAGTTATCAAAGGATCAAGCACCAAAGAATGGCTGATGTTTTCCAGTGGAGGGATAAGAAGCTATCCAGAGCATTGCAGCAGCTCATCTCAAGAGAAACTAATCCCCTCTAAAGTCAAAAAGCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.86

Weight (kDa)

6.81

Isoelectric Point (pI)

44.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 114
AclWI GGATC 1 cut(s) 106
AfiI CCNNNNNNNGG 2 cut(s) 114, 135
AjiI CACGTC 1 cut(s) 7
AluBI AGCT 2 cut(s) 147, 168
AluI AGCT 2 cut(s) 147, 168
AlwI GGATC 1 cut(s) 106
ApeKI GCWGC 3 cut(s) 78, 162, 165
BbvI GCAGC 3 cut(s) 65, 174, 177
BisI GCNGC 3 cut(s) 79, 163, 166
BlsI GCNGC 3 cut(s) 80, 164, 167
BmgBI CACGTC 1 cut(s) 7
BpuEI CTTGAG 2 cut(s) 86, 159
Bsc4I CCNNNNNNNGG 2 cut(s) 114, 135
Bse1I ACTGG 1 cut(s) 129
Bse3DI GCAATG 1 cut(s) 157
BseLI CCNNNNNNNGG 2 cut(s) 114, 135
BseMI GCAATG 1 cut(s) 157
BseNI ACTGG 1 cut(s) 129
BseXI GCAGC 3 cut(s) 65, 174, 177
BslI CCNNNNNNNGG 2 cut(s) 114, 135
Bsp143I GATC 1 cut(s) 98
BspPI GGATC 1 cut(s) 106
BsrDI GCAATG 1 cut(s) 157
BsrI ACTGG 1 cut(s) 129
BssMI GATC 1 cut(s) 98
BstKTI GATC 1 cut(s) 101
BstMBI GATC 1 cut(s) 98
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstV1I GCAGC 3 cut(s) 65, 174, 177
BtrI CACGTC 1 cut(s) 7
BtsIMutI CAGTG 2 cut(s) 136, 208
CviJI RGCY 3 cut(s) 118, 147, 168
CviKI_1 RGCY 3 cut(s) 118, 147, 168
DpnI GATC 1 cut(s) 100
DpnII GATC 1 cut(s) 98
Fnu4HI GCNGC 3 cut(s) 79, 163, 166
Fsp4HI GCNGC 3 cut(s) 79, 163, 166
GluI GCNGC 3 cut(s) 79, 163, 166
Hpy188III TCNNGA 2 cut(s) 152, 176
HpyCH4IV ACGT 1 cut(s) 6
HpyCH4V TGCA 1 cut(s) 162
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
HpySE526I ACGT 1 cut(s) 6
Kzo9I GATC 1 cut(s) 98
LpnPI CCDG 2 cut(s) 142, 165
Lsp1109I GCAGC 3 cut(s) 65, 174, 177
MaeII ACGT 1 cut(s) 6
MalI GATC 1 cut(s) 100
MboI GATC 1 cut(s) 98
MnlI CCTC 2 cut(s) 128, 202
MwoI GCNNNNNNNGC 1 cut(s) 26
NdeII GATC 1 cut(s) 98
PflMI CCANNNNNTGG 1 cut(s) 114
PkrI GCNGC 3 cut(s) 80, 164, 167
SatI GCNGC 3 cut(s) 79, 163, 166
Sau3AI GATC 1 cut(s) 98
SetI ASST 3 cut(s) 9, 149, 170
SgeI CNNG 7 cut(s) 19, 47, 77, 114, 141, 164, 188
SmlI CTYRAG 2 cut(s) 65, 174
SmoI CTYRAG 2 cut(s) 65, 174
TaiI ACGT 1 cut(s) 9
TaqI TCGA 1 cut(s) 49
TscAI CASTG 1 cut(s) 136
TseI GCWGC 3 cut(s) 78, 162, 165
TspRI CASTG 1 cut(s) 136
Van91I CCANNNNNTGG 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.