RchiOBHm_Chr6g0308411

Transporter

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
66509051 .. 66510391
1341 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ27731

Sequence Viewer

Length: 144 bp
ATGGTTATGGATTACAAACTTACATACCCCAGTGGGACTGCCACAACAATGTTGATCAATAGCTTTCACACTAAAAGTGGTGCAGAGCTTGCCGGGAAGCAAGTGCAATGTCTTGAAAAGTATCTAAGCATGAGTTTAATTTGA

Protein Analysis

47

Amino Acids

5.2

Weight (kDa)

7.89

Isoelectric Point (pI)

22.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
OPT PF03169 1 - 43 3.8e-06 OPT oligopeptide transporter protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 116
AluBI AGCT 2 cut(s) 63, 88
AluI AGCT 2 cut(s) 63, 88
AsuC2I CCSGG 1 cut(s) 94
BclI TGATCA 1 cut(s) 54
BcnI CCSGG 1 cut(s) 94
Bme1390I CCNGG 1 cut(s) 94
BmrFI CCNGG 1 cut(s) 94
BmrI ACTGGG 1 cut(s) 24
BmuI ACTGGG 1 cut(s) 24
BpuMI CCSGG 1 cut(s) 94
Bse1I ACTGG 1 cut(s) 30
Bse3DI GCAATG 1 cut(s) 113
BseMI GCAATG 1 cut(s) 113
BseNI ACTGG 1 cut(s) 30
BsgI GTGCAG 1 cut(s) 102
BsiSI CCGG 1 cut(s) 93
BslFI GGGAC 1 cut(s) 49
BsmFI GGGAC 1 cut(s) 49
Bsp143I GATC 1 cut(s) 54
BsrDI GCAATG 1 cut(s) 113
BsrI ACTGG 1 cut(s) 30
BssMI GATC 1 cut(s) 54
BstAPI GCANNNNNTGC 1 cut(s) 89
BstC8I GCNNGC 1 cut(s) 90
BstDEI CTNAG 1 cut(s) 125
BstKTI GATC 1 cut(s) 57
BstMBI GATC 1 cut(s) 54
BstMWI GCNNNNNNNGC 1 cut(s) 89
BstSCI CCNGG 1 cut(s) 92
BtsIMutI CAGTG 1 cut(s) 37
Cac8I GCNNGC 1 cut(s) 90
CviAII CATG 1 cut(s) 130
CviJI RGCY 2 cut(s) 63, 88
CviKI_1 RGCY 2 cut(s) 63, 88
DdeI CTNAG 1 cut(s) 125
DpnI GATC 1 cut(s) 56
DpnII GATC 1 cut(s) 54
FaeI CATG 1 cut(s) 133
FaiI YATR 3 cut(s) 8, 25, 131
FaqI GGGAC 1 cut(s) 49
FatI CATG 1 cut(s) 129
FbaI TGATCA 1 cut(s) 54
HapII CCGG 1 cut(s) 93
Hin1II CATG 1 cut(s) 133
HpaII CCGG 1 cut(s) 93
Hpy188III TCNNGA 1 cut(s) 113
HpyCH4V TGCA 2 cut(s) 83, 106
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
HpyF3I CTNAG 1 cut(s) 125
Hsp92II CATG 1 cut(s) 133
Ksp22I TGATCA 1 cut(s) 54
Kzo9I GATC 1 cut(s) 54
LpnPI CCDG 2 cut(s) 43, 106
MalI GATC 1 cut(s) 56
MboI GATC 1 cut(s) 54
MluCI AATT 1 cut(s) 138
MseI TTAA 1 cut(s) 137
MslI CAYNNNNRTG 1 cut(s) 47
MspI CCGG 1 cut(s) 93
MspR9I CCNGG 1 cut(s) 94
MwoI GCNNNNNNNGC 1 cut(s) 89
NciI CCSGG 1 cut(s) 94
NdeII GATC 1 cut(s) 54
NlaIII CATG 1 cut(s) 133
RseI CAYNNNNRTG 1 cut(s) 47
SaqAI TTAA 1 cut(s) 137
Sau3AI GATC 1 cut(s) 54
ScrFI CCNGG 1 cut(s) 94
SetI ASST 2 cut(s) 65, 90
SgeI CNNG 6 cut(s) 42, 101, 105, 106, 113, 125
SmiMI CAYNNNNRTG 1 cut(s) 47
Sse9I AATT 1 cut(s) 138
StyD4I CCNGG 1 cut(s) 92
TasI AATT 1 cut(s) 138
Tru1I TTAA 1 cut(s) 137
Tru9I TTAA 1 cut(s) 137
TscAI CASTG 1 cut(s) 37
TspRI CASTG 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.