Rh5BG537600

Transporter

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
85107794 .. 85109888
2095 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG537600.1

Sequence Viewer

Length: 195 bp
ATGACAGTGGGATTCGGTTCGTATTTGGTTGCAATGGATGAGAGAACATATAAACTCATCGGGGAGGATTACCCTGGTAACAGGGCAGAAGATGTTATTAATCCGAGCTTGTGGTGGATGACTGGTTTCCTGGTTGTTGTCAGCTTCCTTGGACTTTTTAGTCTTGTTCTGCTTCGCAAGGTTTATATTGCTTAA

Protein Analysis

64

Amino Acids

7.26

Weight (kDa)

4.99

Isoelectric Point (pI)

20.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 159
AjnI CCWGG 2 cut(s) 73, 129
AluBI AGCT 2 cut(s) 108, 144
AluI AGCT 2 cut(s) 108, 144
AseI ATTAAT 1 cut(s) 99
BciT130I CCWGG 2 cut(s) 75, 131
Bme1390I CCNGG 2 cut(s) 75, 131
BmrFI CCNGG 2 cut(s) 75, 131
BsaJI CCNNGG 2 cut(s) 73, 148
Bse1I ACTGG 1 cut(s) 127
Bse3DI GCAATG 1 cut(s) 39
BseBI CCWGG 2 cut(s) 75, 131
BseDI CCNNGG 2 cut(s) 73, 148
BseGI GGATG 2 cut(s) 43, 123
BseMI GCAATG 1 cut(s) 39
BseNI ACTGG 1 cut(s) 127
BsrDI GCAATG 1 cut(s) 39
BsrI ACTGG 1 cut(s) 127
BssECI CCNNGG 2 cut(s) 73, 148
BssT1I CCWWGG 1 cut(s) 148
Bst2UI CCWGG 2 cut(s) 75, 131
Bst4CI ACNGT 1 cut(s) 7
BstF5I GGATG 2 cut(s) 43, 123
BstNI CCWGG 2 cut(s) 75, 131
BstSCI CCNGG 2 cut(s) 73, 129
BtsCI GGATG 2 cut(s) 43, 123
BtsIMutI CAGTG 1 cut(s) 12
CviJI RGCY 2 cut(s) 108, 144
CviKI_1 RGCY 2 cut(s) 108, 144
DrdI GACNNNNNNGTC 1 cut(s) 159
DseDI GACNNNNNNGTC 1 cut(s) 159
Eco130I CCWWGG 1 cut(s) 148
EcoRII CCWGG 2 cut(s) 73, 129
EcoT14I CCWWGG 1 cut(s) 148
ErhI CCWWGG 1 cut(s) 148
FaiI YATR 3 cut(s) 49, 51, 186
FokI GGATG 2 cut(s) 50, 130
HinfI GANTC 1 cut(s) 12
Hpy188I TCNGA 1 cut(s) 105
HpyCH4III ACNGT 1 cut(s) 7
HpyCH4V TGCA 1 cut(s) 32
LpnPI CCDG 6 cut(s) 60, 67, 87, 108, 116, 143
MaeIII GTNAC 1 cut(s) 77
MboII GAAGA 1 cut(s) 101
MnlI CCTC 1 cut(s) 58
MseI TTAA 2 cut(s) 99, 193
MspR9I CCNGG 2 cut(s) 75, 131
MvaI CCWGG 2 cut(s) 75, 131
PfeI GAWTC 1 cut(s) 12
PshBI ATTAAT 1 cut(s) 99
Psp6I CCWGG 2 cut(s) 73, 129
PspGI CCWGG 2 cut(s) 73, 129
SaqAI TTAA 2 cut(s) 99, 193
ScrFI CCNGG 2 cut(s) 75, 131
SetI ASST 3 cut(s) 110, 146, 183
StyD4I CCNGG 2 cut(s) 73, 129
StyI CCWWGG 1 cut(s) 148
TaaI ACNGT 1 cut(s) 7
TfiI GAWTC 1 cut(s) 12
Tru1I TTAA 2 cut(s) 99, 193
Tru9I TTAA 2 cut(s) 99, 193
TscAI CASTG 1 cut(s) 12
TspRI CASTG 1 cut(s) 12
VspI ATTAAT 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.