Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8009524.1

Orthogroup ID

OG0000919

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 422

Gene Structure 421 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8009524.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 421 bp

atgagtgcgtttggtccattttgggatcacattttggggtactggaaagagagcttgaagagacctaacaatgtgttattcttgaagtacgaggacatgaaggaagatggtgtagttcacttgaaggcattggctaagtttttagactgccctttcactgaggaggaggagagaaatggtgtgattgaagcaatagcaaagctctgttcttttgaggccatgaaaaagttggagatcaacaaaactggaacgtttgtcatgaactgggagaacaagaccctgttcagaaaagctgaggtgggagattggattaactatttgacccctaagatggaggagagaatgtctaaagtcatagaagaaaagttgggtggttcaggcttgactttcaaagtgattcccgagctagcagatcctgtcc

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0002376 GO:0003674 GO:0003824 GO:0006082 GO:0006790 GO:0006807 GO:0006950 GO:0006952 GO:0006955 GO:0008146 GO:0008150 GO:0008152 GO:0009058 GO:0009605 GO:0009607 GO:0009611 GO:0009694 GO:0009719 GO:0009725 GO:0009753 GO:0009814 GO:0009861 GO:0009987 GO:0010033 GO:0010817 GO:0016143 GO:0016144 GO:0016740 GO:0016782 GO:0019748 GO:0019752 GO:0019757 GO:0019758 GO:0019760 GO:0019761 GO:0032260 GO:0032787 GO:0042221 GO:0042445 GO:0043207 GO:0043436 GO:0044237 GO:0044249 GO:0044272 GO:0044281 GO:0044550 GO:0045087 GO:0047364 GO:0050896 GO:0051704 GO:0051707 GO:0065007 GO:0065008 GO:0071704 GO:0080131 GO:0098542 GO:1901135 GO:1901137 GO:1901564 GO:1901566 GO:1901576 GO:1901657 GO:1901659 GO:1901700

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Sulfotransfer_1

Protein Analysis

140

Amino Acids

16.18

Weight (kDa)

5.52

Isoelectric Point (pI)

52.95

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000919)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G07000 AT5G07010
fragaria_vesca	FvH4_1g19370 FvH4_2g35250 FvH4_7g03900 FvH4_7g13440 FvH4_7g13441 FvH4_7g13451
malus_domestica	MD00G1152400.v1.1
prunus_persica	Prupe.2G043800_v2.0.a1
pyrus_communis	pycom02g23670
rosa_chinensis	RchiOBHm_Chr1g0327381 RchiOBHm_Chr1g0327411 RchiOBHm_Chr1g0327441 RchiOBHm_Chr1g0352791 RchiOBHm_Chr1g0353081 RchiOBHm_Chr2g0131991 RchiOBHm_Chr2g0132001
rosa_laevigata	RLG00000019222 RLG00000028292 RLG00000029994 RLG00000029995
rosa_multiflora	Rmu_co8009524.1_g000001 Rmu_sc0000584.1_g000024 Rmu_sc0001207.1_g000090 Rmu_sc0003600.1_g000014 Rmu_sc0003600.1_g000021 Rmu_sc0006445.1_g000009 Rmu_sc0008840.1_g000008 Rmu_sc0011915.1_g000012
rosa_roxburghii	Rroxscaffold_4G00302090 Rroxscaffold_4G00302300 Rroxscaffold_4G00302320 Rroxscaffold_4G00302340 Rroxscaffold_4G00302350 Rroxscaffold_4G00322710
rosa_rugosa	Rorug01G0066900 Rorug01G0067100 Rorug01G0233600 Rorug02G0301800.1
rosa_samantha	Rh1AG083700 Rh1AG083800 Rh1AG246900 Rh1BG066600 Rh1BG066800 Rh1BG217000 Rh1CG081700 Rh1CG230600 Rh1DG088000 Rh1DG088300 Rh1DG243100 Rh2AG353100 Rh2AG353200 Rh2BG360700 Rh2BG360800 Rh2CG338400 Rh2DG377500
rosa_wichuraiana	Rw0G018120 Rw1G006570 Rw1G006590 Rw1G020810 Rw1G021360 Rw1G021490 Rw2G028800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclI	AACGTT	1 cut(s)	251
AclWI	GGATC	2 cut(s)	33, 407
AfaI	GTAC	2 cut(s)	41, 89
AfiI	CCNNNNNNNGG	1 cut(s)	331
AgsI	TTSAA	5 cut(s)	58, 85, 124, 188, 391
AluBI	AGCT	4 cut(s)	54, 202, 293, 406
AluI	AGCT	4 cut(s)	54, 202, 293, 406
Alw26I	GTCTC	1 cut(s)	55
AlwI	GGATC	2 cut(s)	33, 407
AlwNI	CAGNNNCTG	1 cut(s)	416
Ama87I	CYCGRG	1 cut(s)	401
AoxI	GGCC	1 cut(s)	216
AspS9I	GGNCC	1 cut(s)	14
AsuNHI	GCTAGC	1 cut(s)	406
AvaI	CYCGRG	1 cut(s)	401
AvaII	GGWCC	1 cut(s)	14
BbvCI	CCTCAGC	1 cut(s)	294
BccI	CCATC	2 cut(s)	101, 325
BcoDI	GTCTC	1 cut(s)	55
BfaI	CTAG	1 cut(s)	407
Bme18I	GGWCC	1 cut(s)	14
BmeT110I	CYCGRG	1 cut(s)	401
BmgT120I	GGNCC	1 cut(s)	14
BmrI	ACTGGG	1 cut(s)	274
BmtI	GCTAGC	1 cut(s)	410
BmuI	ACTGGG	1 cut(s)	274
Bpu10I	CCTNAGC	1 cut(s)	294
BsaI	GGTCTC	1 cut(s)	55
BsaXI	ACNNNNNCTCC	2 cut(s)	329, 359
Bsc4I	CCNNNNNNNGG	1 cut(s)	331
Bse1I	ACTGG	3 cut(s)	47, 250, 269
BseLI	CCNNNNNNNGG	1 cut(s)	331
BseMII	CTCAG	2 cut(s)	150, 285
BseNI	ACTGG	3 cut(s)	47, 250, 269
BseRI	GAGGAG	4 cut(s)	176, 179, 182, 350
BshFI	GGCC	1 cut(s)	218
BsiHKCI	CYCGRG	1 cut(s)	401
BslI	CCNNNNNNNGG	1 cut(s)	331
BsmAI	GTCTC	1 cut(s)	55
BsnI	GGCC	1 cut(s)	218
Bso31I	GGTCTC	1 cut(s)	55
BsoBI	CYCGRG	1 cut(s)	401
Bsp143I	GATC	3 cut(s)	25, 234, 412
BspANI	GGCC	1 cut(s)	218
BspCNI	CTCAG	2 cut(s)	151, 286
BspHI	TCATGA	1 cut(s)	258
BspOI	GCTAGC	1 cut(s)	410
BspPI	GGATC	2 cut(s)	33, 407
BspTNI	GGTCTC	1 cut(s)	55
BsrI	ACTGG	3 cut(s)	47, 250, 269
BssMI	GATC	3 cut(s)	25, 234, 412
Bst6I	CTCTTC	1 cut(s)	53
BstC8I	GCNNGC	1 cut(s)	408
BstDEI	CTNAG	4 cut(s)	135, 159, 294, 327
BstKTI	GATC	3 cut(s)	28, 237, 415
BstMAI	GTCTC	1 cut(s)	55
BstMBI	GATC	3 cut(s)	25, 234, 412
BstX2I	RGATCY	1 cut(s)	412
BstYI	RGATCY	1 cut(s)	412
BsuRI	GGCC	1 cut(s)	218
BtsIMutI	CAGTG	1 cut(s)	156
Cac8I	GCNNGC	1 cut(s)	408
CaiI	CAGNNNCTG	1 cut(s)	416
CciI	TCATGA	1 cut(s)	258
Cfr13I	GGNCC	1 cut(s)	14
Csp6I	GTAC	2 cut(s)	40, 88
CviAII	CATG	3 cut(s)	97, 220, 259
CviJI	RGCY	7 cut(s)	54, 134, 202, 218, 293, 381, 406
CviKI_1	RGCY	7 cut(s)	54, 134, 202, 218, 293, 381, 406
CviQI	GTAC	2 cut(s)	40, 88
DdeI	CTNAG	4 cut(s)	135, 159, 294, 327
DpnI	GATC	3 cut(s)	27, 236, 414
DpnII	GATC	3 cut(s)	25, 234, 412
Eam1104I	CTCTTC	1 cut(s)	53
EarI	CTCTTC	1 cut(s)	53
Eco31I	GGTCTC	1 cut(s)	55
Eco47I	GGWCC	1 cut(s)	14
Eco88I	CYCGRG	1 cut(s)	401
FaeI	CATG	3 cut(s)	100, 223, 262
FaiI	YATR	4 cut(s)	98, 221, 260, 356
FatI	CATG	3 cut(s)	96, 219, 258
FspBI	CTAG	1 cut(s)	407
HaeIII	GGCC	1 cut(s)	218
Hin1II	CATG	3 cut(s)	100, 223, 262
HinfI	GANTC	1 cut(s)	397
Hpy166II	GTNNAC	1 cut(s)	118
Hpy188I	TCNGA	1 cut(s)	287
Hpy188III	TCNNGA	3 cut(s)	82, 259, 401
Hpy8I	GTNNAC	1 cut(s)	118
HpyAV	CCTTC	2 cut(s)	94, 118
HpyCH4IV	ACGT	1 cut(s)	251
HpyF3I	CTNAG	4 cut(s)	135, 159, 294, 327
HpySE526I	ACGT	1 cut(s)	251
Hsp92II	CATG	3 cut(s)	100, 223, 262
Kzo9I	GATC	3 cut(s)	25, 234, 412
LpnPI	CCDG	5 cut(s)	28, 231, 250, 293, 363
MaeI	CTAG	1 cut(s)	407
MaeII	ACGT	1 cut(s)	251
MalI	GATC	3 cut(s)	27, 236, 414
MboI	GATC	3 cut(s)	25, 234, 412
MboII	GAAGA	3 cut(s)	70, 116, 371
MflI	RGATCY	1 cut(s)	412
MmeI	TCCRAC	1 cut(s)	210
MnlI	CCTC	7 cut(s)	85, 154, 157, 160, 208, 289, 328
MseI	TTAA	1 cut(s)	312
NdeII	GATC	3 cut(s)	25, 234, 412
NheI	GCTAGC	1 cut(s)	406
NlaIII	CATG	3 cut(s)	100, 223, 262
PagI	TCATGA	1 cut(s)	258
PfeI	GAWTC	1 cut(s)	397
Psp1406I	AACGTT	1 cut(s)	251
PspPI	GGNCC	1 cut(s)	14
PstNI	CAGNNNCTG	1 cut(s)	416
PsuI	RGATCY	1 cut(s)	412
RsaI	GTAC	2 cut(s)	41, 89
RsaNI	GTAC	2 cut(s)	40, 88
SaqAI	TTAA	1 cut(s)	312
Sau3AI	GATC	3 cut(s)	25, 234, 412
Sau96I	GGNCC	1 cut(s)	14
SetI	ASST	7 cut(s)	56, 67, 204, 254, 295, 300, 408
SinI	GGWCC	1 cut(s)	14
SspMI	CTAG	1 cut(s)	407
TaiI	ACGT	1 cut(s)	254
TfiI	GAWTC	1 cut(s)	397
Tru1I	TTAA	1 cut(s)	312
Tru9I	TTAA	1 cut(s)	312
TscAI	CASTG	1 cut(s)	163
TspDTI	ATGAA	3 cut(s)	113, 236, 275
TspRI	CASTG	1 cut(s)	163
VpaK11BI	GGWCC	1 cut(s)	14
XcmI	CCANNNNNNNNNTGG	1 cut(s)	226
XspI	CTAG	1 cut(s)	407

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.