Rmu_co8131160.1_g000001

Leucine aminopeptidase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8131160.1
Physical Location & Seq
Reverse (-)
2 .. 528
527 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8131160.1_g000001.1.cds

Sequence Viewer

Length: 180 bp
atggctcacactatcgctcgcgccactctcggcctcactcatatttctccggcctttgaagcccctaagctcactttcgcgacgaaagagattgatgtaacggaatggaaaggggacctgcttgcggttggtgttacagagaaggacttggcgaaagatcagaactcgaaattcgaaaat

Protein Analysis

60

Amino Acids

6.57

Weight (kDa)

5.51

Isoelectric Point (pI)

32.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 126
AccII CGCG 2 cut(s) 21, 80
AciI CCGC 1 cut(s) 125
AcsI RAATTY 1 cut(s) 170
AfiI CCNNNNNNNGG 1 cut(s) 124
AgsI TTSAA 1 cut(s) 59
AluBI AGCT 1 cut(s) 70
AluI AGCT 1 cut(s) 70
AoxI GGCC 2 cut(s) 31, 51
ApoI RAATTY 1 cut(s) 170
AspLEI GCGC 1 cut(s) 23
AspS9I GGNCC 1 cut(s) 115
AsuII TTCGAA 1 cut(s) 174
AvaII GGWCC 1 cut(s) 115
BfuAI ACCTGC 1 cut(s) 126
Bme18I GGWCC 1 cut(s) 115
BmgT120I GGNCC 1 cut(s) 115
BmiI GGNNCC 1 cut(s) 116
Bpu10I CCTNAGC 1 cut(s) 66
Bpu14I TTCGAA 1 cut(s) 174
Bsc4I CCNNNNNNNGG 1 cut(s) 124
BseLI CCNNNNNNNGG 1 cut(s) 124
Bsh1236I CGCG 2 cut(s) 21, 80
BshFI GGCC 2 cut(s) 33, 53
BsiSI CCGG 1 cut(s) 50
BslFI GGGAC 1 cut(s) 128
BslI CCNNNNNNNGG 1 cut(s) 124
BsmFI GGGAC 1 cut(s) 128
BsnI GGCC 2 cut(s) 33, 53
Bsp119I TTCGAA 1 cut(s) 174
Bsp143I GATC 1 cut(s) 157
Bsp68I TCGCGA 1 cut(s) 80
BspACI CCGC 1 cut(s) 125
BspANI GGCC 2 cut(s) 33, 53
BspFNI CGCG 2 cut(s) 21, 80
BspLI GGNNCC 1 cut(s) 116
BspMI ACCTGC 1 cut(s) 126
BspT104I TTCGAA 1 cut(s) 174
BssMI GATC 1 cut(s) 157
BstBI TTCGAA 1 cut(s) 174
BstC8I GCNNGC 2 cut(s) 19, 123
BstDEI CTNAG 1 cut(s) 66
BstFNI CGCG 2 cut(s) 21, 80
BstHHI GCGC 1 cut(s) 23
BstKTI GATC 1 cut(s) 160
BstMBI GATC 1 cut(s) 157
BstMWI GCNNNNNNNGC 1 cut(s) 59
BstUI CGCG 2 cut(s) 21, 80
BsuRI GGCC 2 cut(s) 33, 53
BtuMI TCGCGA 1 cut(s) 80
BveI ACCTGC 1 cut(s) 126
Cac8I GCNNGC 2 cut(s) 19, 123
CfoI GCGC 1 cut(s) 23
Cfr13I GGNCC 1 cut(s) 115
CviJI RGCY 5 cut(s) 5, 33, 53, 62, 70
CviKI_1 RGCY 5 cut(s) 5, 33, 53, 62, 70
DdeI CTNAG 1 cut(s) 66
DpnI GATC 1 cut(s) 159
DpnII GATC 1 cut(s) 157
Eco47I GGWCC 1 cut(s) 115
EcoO109I RGGNCCY 1 cut(s) 115
FaiI YATR 1 cut(s) 42
FaqI GGGAC 1 cut(s) 128
GlaI GCGC 1 cut(s) 22
HaeIII GGCC 2 cut(s) 33, 53
HapII CCGG 1 cut(s) 50
HhaI GCGC 1 cut(s) 23
Hin6I GCGC 1 cut(s) 21
HinP1I GCGC 1 cut(s) 21
HpaII CCGG 1 cut(s) 50
Hpy188I TCNGA 1 cut(s) 162
Hpy188III TCNNGA 1 cut(s) 79
Hpy99I CGWCG 1 cut(s) 85
HpyAV CCTTC 1 cut(s) 136
HpyF10VI GCNNNNNNNGC 1 cut(s) 59
HpyF3I CTNAG 1 cut(s) 66
HspAI GCGC 1 cut(s) 21
Kzo9I GATC 1 cut(s) 157
LpnPI CCDG 2 cut(s) 63, 131
MaeIII GTNAC 2 cut(s) 97, 133
MalI GATC 1 cut(s) 159
MboI GATC 1 cut(s) 157
MluCI AATT 1 cut(s) 170
MnlI CCTC 1 cut(s) 44
MspI CCGG 1 cut(s) 50
MvnI CGCG 2 cut(s) 21, 80
MwoI GCNNNNNNNGC 1 cut(s) 59
NdeII GATC 1 cut(s) 157
NlaIV GGNNCC 1 cut(s) 116
NmeAIII GCCGAG 1 cut(s) 9
NruI TCGCGA 1 cut(s) 80
NspV TTCGAA 1 cut(s) 174
PpuMI RGGWCCY 1 cut(s) 115
Psp5II RGGWCCY 1 cut(s) 115
PspN4I GGNNCC 1 cut(s) 116
PspPI GGNCC 1 cut(s) 115
PspPPI RGGWCCY 1 cut(s) 115
RruI TCGCGA 1 cut(s) 80
Sau3AI GATC 1 cut(s) 157
Sau96I GGNCC 1 cut(s) 115
SetI ASST 2 cut(s) 72, 120
SfuI TTCGAA 1 cut(s) 174
SgeI CNNG 8 cut(s) 30, 32, 41, 62, 91, 130, 134, 160
SinI GGWCC 1 cut(s) 115
Sse9I AATT 1 cut(s) 170
SsiI CCGC 1 cut(s) 125
TaqI TCGA 2 cut(s) 167, 174
TasI AATT 1 cut(s) 170
TspGWI ACGGA 1 cut(s) 116
VpaK11BI GGWCC 1 cut(s) 115
XapI RAATTY 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.