Rh4CG268800

Leucine aminopeptidase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
52327367 .. 52327570
204 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG268800.1

Sequence Viewer

Length: 204 bp
ATGAAGCTCACTTTCGAGACGAAAGAGATTGATGTAACGGAATGGAAAGGGGACCTGCTTGCGGTTGGTGTTACAGAGAAGGACTTGAGGAAAGGTCAGAACTCAAAATTCGAAAATCCGATATTGAAGAAGCTGGATTCTTGTTTGGGTGGGGTGTTGGCTGAGGTCTCGACTAAGGAGGACTTCACAGGAAAGTCTGGCTAG

Protein Analysis

67

Amino Acids

7.37

Weight (kDa)

5.36

Isoelectric Point (pI)

24.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 63
AciI CCGC 1 cut(s) 62
AcsI RAATTY 1 cut(s) 107
AfiI CCNNNNNNNGG 1 cut(s) 61
AgsI TTSAA 1 cut(s) 127
AluBI AGCT 2 cut(s) 7, 133
AluI AGCT 2 cut(s) 7, 133
Alw26I GTCTC 2 cut(s) 11, 172
ApoI RAATTY 1 cut(s) 107
AspS9I GGNCC 1 cut(s) 52
AsuII TTCGAA 1 cut(s) 111
AvaII GGWCC 1 cut(s) 52
BbvCI CCTCAGC 1 cut(s) 162
BcoDI GTCTC 2 cut(s) 11, 172
BfaI CTAG 1 cut(s) 202
BfuAI ACCTGC 1 cut(s) 63
Bme18I GGWCC 1 cut(s) 52
BmgT120I GGNCC 1 cut(s) 52
BmiI GGNNCC 1 cut(s) 53
Bpu10I CCTNAGC 1 cut(s) 162
Bpu14I TTCGAA 1 cut(s) 111
BpuEI CTTGAG 1 cut(s) 106
BsaI GGTCTC 1 cut(s) 172
Bsc4I CCNNNNNNNGG 1 cut(s) 61
BseLI CCNNNNNNNGG 1 cut(s) 61
BseMII CTCAG 1 cut(s) 153
BslFI GGGAC 1 cut(s) 65
BslI CCNNNNNNNGG 1 cut(s) 61
BsmAI GTCTC 2 cut(s) 11, 172
BsmBI CGTCTC 1 cut(s) 11
BsmFI GGGAC 1 cut(s) 65
Bso31I GGTCTC 1 cut(s) 172
Bsp119I TTCGAA 1 cut(s) 111
BspACI CCGC 1 cut(s) 62
BspCNI CTCAG 1 cut(s) 154
BspLI GGNNCC 1 cut(s) 53
BspMI ACCTGC 1 cut(s) 63
BspT104I TTCGAA 1 cut(s) 111
BspTNI GGTCTC 1 cut(s) 172
BstBI TTCGAA 1 cut(s) 111
BstC8I GCNNGC 1 cut(s) 60
BstDEI CTNAG 2 cut(s) 162, 174
BstMAI GTCTC 2 cut(s) 11, 172
BveI ACCTGC 1 cut(s) 63
Cac8I GCNNGC 1 cut(s) 60
Cfr13I GGNCC 1 cut(s) 52
CviJI RGCY 4 cut(s) 7, 133, 161, 201
CviKI_1 RGCY 4 cut(s) 7, 133, 161, 201
DdeI CTNAG 2 cut(s) 162, 174
Eco31I GGTCTC 1 cut(s) 172
Eco47I GGWCC 1 cut(s) 52
EcoO109I RGGNCCY 1 cut(s) 52
Esp3I CGTCTC 1 cut(s) 11
FalI AAGNNNNNCTT 2 cut(s) 167, 199
FaqI GGGAC 1 cut(s) 65
FspBI CTAG 1 cut(s) 202
HinfI GANTC 1 cut(s) 137
Hpy188I TCNGA 2 cut(s) 99, 120
Hpy188III TCNNGA 2 cut(s) 16, 169
HpyAV CCTTC 1 cut(s) 73
HpyF3I CTNAG 2 cut(s) 162, 174
LpnPI CCDG 4 cut(s) 68, 119, 174, 183
MaeI CTAG 1 cut(s) 202
MaeIII GTNAC 2 cut(s) 34, 70
MboII GAAGA 1 cut(s) 139
MluCI AATT 1 cut(s) 107
MnlI CCTC 3 cut(s) 81, 157, 172
NlaIV GGNNCC 1 cut(s) 53
NspV TTCGAA 1 cut(s) 111
PfeI GAWTC 1 cut(s) 137
PpuMI RGGWCCY 1 cut(s) 52
Psp5II RGGWCCY 1 cut(s) 52
PspN4I GGNNCC 1 cut(s) 53
PspPI GGNCC 1 cut(s) 52
PspPPI RGGWCCY 1 cut(s) 52
Sau96I GGNCC 1 cut(s) 52
SetI ASST 5 cut(s) 9, 57, 97, 135, 168
SfuI TTCGAA 1 cut(s) 111
SgeI CNNG 7 cut(s) 28, 67, 71, 97, 146, 153, 181
SinI GGWCC 1 cut(s) 52
SmlI CTYRAG 1 cut(s) 85
SmoI CTYRAG 1 cut(s) 85
Sse9I AATT 1 cut(s) 107
SsiI CCGC 1 cut(s) 62
SspMI CTAG 1 cut(s) 202
TaqI TCGA 3 cut(s) 15, 111, 170
TasI AATT 1 cut(s) 107
TfiI GAWTC 1 cut(s) 137
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 53
VpaK11BI GGWCC 1 cut(s) 52
XapI RAATTY 1 cut(s) 107
XspI CTAG 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.