Rmu_co8237971.1_g000001

DNA polymerase III

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8237971.1
Physical Location & Seq
Forward (+)
46 .. 637
592 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8237971.1_g000001.1.cds

Sequence Viewer

Length: 480 bp
atgatcactcctgatctggataagctgccgcggaatgcagtatcacggtcccagagatatcactttccaaagattaaggatggtgatattgcaagcaagttgggaaaaatctgtgttgtagagggtcttgaatttgatcaggttgctttgaacttcattgctgccaaatcaaatggttcacttagggatgcagagatgatgcttgatcagctaagtttgcttggtaaaagaatcacaatgggcctggcatacgagcttattggagctgtttctgatgatgaattgcttgatttgctagatctggcattgtcatctgacacttctaatacagttataagggccagggagttgatgagatcaaggattgatcccatgcaacttatatcgcagttggcaaatcttattatggacatccttgctggtgaggaaggtggttctgaagtccagaaaaagttttctcgtaggcatacctgtaagtag

Protein Analysis

159

Amino Acids

17.64

Weight (kDa)

5.72

Isoelectric Point (pI)

26.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 335
AccII CGCG 1 cut(s) 31
AciI CCGC 2 cut(s) 29, 31
AclWI GGATC 1 cut(s) 362
AcsI RAATTY 1 cut(s) 131
AcuI CTGAAG 1 cut(s) 459
AgsI TTSAA 2 cut(s) 131, 151
AjnI CCWGG 2 cut(s) 243, 341
AluBI AGCT 4 cut(s) 25, 211, 256, 266
AluI AGCT 4 cut(s) 25, 211, 256, 266
AlwI GGATC 1 cut(s) 362
AoxI GGCC 2 cut(s) 241, 339
ApeKI GCWGC 2 cut(s) 25, 161
ApoI RAATTY 1 cut(s) 131
AspS9I GGNCC 3 cut(s) 48, 241, 339
AsuHPI GGTGA 2 cut(s) 95, 434
AvaII GGWCC 1 cut(s) 48
BbvI GCAGC 2 cut(s) 12, 148
BccI CCATC 1 cut(s) 74
BciT130I CCWGG 2 cut(s) 245, 343
BclI TGATCA 3 cut(s) 3, 136, 205
BfaI CTAG 1 cut(s) 296
BglII AGATCT 1 cut(s) 298
BisI GCNGC 3 cut(s) 26, 29, 162
BlsI GCNGC 3 cut(s) 27, 30, 163
Bme1390I CCNGG 2 cut(s) 245, 343
Bme18I GGWCC 1 cut(s) 48
BmgT120I GGNCC 3 cut(s) 48, 241, 339
BmiI GGNNCC 1 cut(s) 50
BmrFI CCNGG 2 cut(s) 245, 343
BmsI GCATC 2 cut(s) 178, 189
BsaJI CCNNGG 2 cut(s) 29, 342
Bse3DI GCAATG 1 cut(s) 156
BseBI CCWGG 2 cut(s) 245, 343
BseDI CCNNGG 2 cut(s) 29, 342
BseGI GGATG 3 cut(s) 85, 193, 411
BseMI GCAATG 1 cut(s) 156
BseXI GCAGC 2 cut(s) 12, 148
Bsh1236I CGCG 1 cut(s) 31
BshFI GGCC 2 cut(s) 243, 341
BslFI GGGAC 1 cut(s) 34
BsmFI GGGAC 1 cut(s) 34
BsmI GAATGC 1 cut(s) 40
BsnI GGCC 2 cut(s) 243, 341
Bsp143I GATC 7 cut(s) 3, 13, 136, 205, 298, 356, 367
BspACI CCGC 2 cut(s) 29, 31
BspANI GGCC 2 cut(s) 243, 341
BspFNI CGCG 1 cut(s) 31
BspLI GGNNCC 1 cut(s) 50
BspPI GGATC 1 cut(s) 362
BsrDI GCAATG 1 cut(s) 156
BssECI CCNNGG 2 cut(s) 29, 342
BssMI GATC 7 cut(s) 3, 13, 136, 205, 298, 356, 367
Bst2UI CCWGG 2 cut(s) 245, 343
Bst4CI ACNGT 2 cut(s) 48, 331
BstC8I GCNNGC 1 cut(s) 94
BstDEI CTNAG 2 cut(s) 182, 212
BstDSI CCRYGG 1 cut(s) 29
BstF5I GGATG 3 cut(s) 85, 193, 411
BstFNI CGCG 1 cut(s) 31
BstKTI GATC 7 cut(s) 6, 16, 139, 208, 301, 359, 370
BstMBI GATC 7 cut(s) 3, 13, 136, 205, 298, 356, 367
BstMWI GCNNNNNNNGC 3 cut(s) 208, 217, 292
BstNI CCWGG 2 cut(s) 245, 343
BstSCI CCNGG 2 cut(s) 243, 341
BstUI CGCG 1 cut(s) 31
BstV1I GCAGC 2 cut(s) 12, 148
BstX2I RGATCY 1 cut(s) 298
BstYI RGATCY 1 cut(s) 298
BsuRI GGCC 2 cut(s) 243, 341
BtgI CCRYGG 1 cut(s) 29
BtsCI GGATG 3 cut(s) 85, 193, 411
Cac8I GCNNGC 1 cut(s) 94
Cfr13I GGNCC 3 cut(s) 48, 241, 339
Cfr42I CCGCGG 1 cut(s) 32
CviAII CATG 1 cut(s) 373
CviJI RGCY 6 cut(s) 25, 211, 243, 256, 266, 341
CviKI_1 RGCY 6 cut(s) 25, 211, 243, 256, 266, 341
DdeI CTNAG 2 cut(s) 182, 212
DpnI GATC 7 cut(s) 5, 15, 138, 207, 300, 358, 369
DpnII GATC 7 cut(s) 3, 13, 136, 205, 298, 356, 367
Eco32I GATATC 1 cut(s) 59
Eco47I GGWCC 1 cut(s) 48
Eco57I CTGAAG 1 cut(s) 459
EcoRII CCWGG 2 cut(s) 243, 341
EcoRV GATATC 1 cut(s) 59
FaeI CATG 1 cut(s) 376
FaiI YATR 6 cut(s) 250, 335, 374, 383, 407, 468
FaqI GGGAC 1 cut(s) 34
FatI CATG 1 cut(s) 372
FbaI TGATCA 3 cut(s) 3, 136, 205
Fnu4HI GCNGC 3 cut(s) 26, 29, 162
FokI GGATG 3 cut(s) 92, 200, 398
Fsp4HI GCNGC 3 cut(s) 26, 29, 162
FspBI CTAG 1 cut(s) 296
GluI GCNGC 3 cut(s) 26, 29, 162
HaeIII GGCC 2 cut(s) 243, 341
Hin1II CATG 1 cut(s) 376
HinfI GANTC 1 cut(s) 231
HphI GGTGA 2 cut(s) 95, 434
Hpy166II GTNNAC 1 cut(s) 179
Hpy188I TCNGA 3 cut(s) 274, 316, 439
Hpy188III TCNNGA 4 cut(s) 11, 17, 128, 445
Hpy8I GTNNAC 1 cut(s) 179
HpyAV CCTTC 1 cut(s) 422
HpyCH4III ACNGT 2 cut(s) 48, 331
HpyCH4V TGCA 4 cut(s) 38, 92, 191, 376
HpyF10VI GCNNNNNNNGC 3 cut(s) 208, 217, 292
HpyF3I CTNAG 2 cut(s) 182, 212
Hsp92II CATG 1 cut(s) 376
Ksp22I TGATCA 3 cut(s) 3, 136, 205
KspI CCGCGG 1 cut(s) 32
Kzo9I GATC 7 cut(s) 3, 13, 136, 205, 298, 356, 367
LmnI GCTCC 1 cut(s) 263
Lsp1109I GCAGC 2 cut(s) 12, 148
LweI GCATC 2 cut(s) 178, 189
MaeI CTAG 1 cut(s) 296
MalI GATC 7 cut(s) 5, 15, 138, 207, 300, 358, 369
MboI GATC 7 cut(s) 3, 13, 136, 205, 298, 356, 367
MflI RGATCY 1 cut(s) 298
MluCI AATT 2 cut(s) 131, 281
MnlI CCTC 2 cut(s) 115, 418
MseI TTAA 1 cut(s) 75
MspA1I CMGCKG 1 cut(s) 31
MspR9I CCNGG 2 cut(s) 245, 343
Mva1269I GAATGC 1 cut(s) 40
MvaI CCWGG 2 cut(s) 245, 343
MvnI CGCG 1 cut(s) 31
MwoI GCNNNNNNNGC 3 cut(s) 208, 217, 292
NdeII GATC 7 cut(s) 3, 13, 136, 205, 298, 356, 367
NlaIII CATG 1 cut(s) 376
NlaIV GGNNCC 1 cut(s) 50
PctI GAATGC 1 cut(s) 40
PfeI GAWTC 1 cut(s) 231
PkrI GCNGC 3 cut(s) 27, 30, 163
PsiI TTATAA 1 cut(s) 335
Psp6I CCWGG 2 cut(s) 243, 341
PspGI CCWGG 2 cut(s) 243, 341
PspN4I GGNNCC 1 cut(s) 50
PspPI GGNCC 3 cut(s) 48, 241, 339
PsuI RGATCY 1 cut(s) 298
SacII CCGCGG 1 cut(s) 32
SaqAI TTAA 1 cut(s) 75
SatI GCNGC 3 cut(s) 26, 29, 162
Sau3AI GATC 7 cut(s) 3, 13, 136, 205, 298, 356, 367
Sau96I GGNCC 3 cut(s) 48, 241, 339
ScrFI CCNGG 2 cut(s) 245, 343
SetI ASST 7 cut(s) 27, 144, 213, 258, 268, 433, 473
SfaNI GCATC 2 cut(s) 178, 189
Sfr303I CCGCGG 1 cut(s) 32
SgrBI CCGCGG 1 cut(s) 32
SinI GGWCC 1 cut(s) 48
Sse9I AATT 2 cut(s) 131, 281
SsiI CCGC 2 cut(s) 29, 31
SspMI CTAG 1 cut(s) 296
StyD4I CCNGG 2 cut(s) 243, 341
TaaI ACNGT 2 cut(s) 48, 331
TasI AATT 2 cut(s) 131, 281
TauI GCSGC 1 cut(s) 31
TfiI GAWTC 1 cut(s) 231
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TseI GCWGC 2 cut(s) 25, 161
TspDTI ATGAA 2 cut(s) 145, 294
VpaK11BI GGWCC 1 cut(s) 48
XapI RAATTY 1 cut(s) 131
XspI CTAG 1 cut(s) 296
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.