Rmu_co8254929.1_g000001

Hydrolyzes acetyl esters in homogalacturonan regions of pectin. In type I primary cell wall, galacturonic acid residues of pectin can be acetylated at the O-2 and O-3 positions. Decreasing the degree of acetylation of pectin gels in vitro alters their physical properties

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8254929.1
OG0000996
Physical Location & Seq
Reverse (-)
181 .. 719
539 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8254929.1_g000001.1.cds

Sequence Viewer

Length: 270 bp
atgcaagattataggttacagttcttagatgtactcaatggtggtctcaccaactctccatctcatggagcattcatagactcttgctatgctcactgccaaatcggaactcaagagacatggatggcatctgactccccggttgtcagtaagacgacaattgcaaaggccgtcggagactggtattacaaccgaagtccatcaaaaaagatcgattgtccttacccttgcaatcctacctgcaaaaataaagaatttgattcaaactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04310 map04310
Pfam Domains
Protein Families
PAE

Protein Analysis

89

Amino Acids

9.96

Weight (kDa)

6.01

Isoelectric Point (pI)

53.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 248
AccB7I CCANNNNNTGG 1 cut(s) 65
AcsI RAATTY 1 cut(s) 254
AfaI GTAC 1 cut(s) 33
AfiI CCNNNNNNNGG 1 cut(s) 65
AgsI TTSAA 1 cut(s) 264
Alw26I GTCTC 3 cut(s) 50, 110, 171
AoxI GGCC 1 cut(s) 168
ApoI RAATTY 1 cut(s) 254
AsuC2I CCSGG 1 cut(s) 140
AsuHPI GGTGA 1 cut(s) 40
BccI CCATC 3 cut(s) 67, 118, 208
BceAI ACGGC 1 cut(s) 155
BcnI CCSGG 1 cut(s) 140
BcoDI GTCTC 3 cut(s) 50, 110, 171
BfaI CTAG 1 cut(s) 268
BfuAI ACCTGC 1 cut(s) 248
Bme1390I CCNGG 1 cut(s) 140
BmrFI CCNGG 1 cut(s) 140
BmsI GCATC 1 cut(s) 137
BpuEI CTTGAG 1 cut(s) 96
BpuMI CCSGG 1 cut(s) 140
Bsa29I ATCGAT 1 cut(s) 213
BsaI GGTCTC 1 cut(s) 50
BsaJI CCNNGG 1 cut(s) 138
BsaXI ACNNNNNCTCC 2 cut(s) 40, 70
Bsc4I CCNNNNNNNGG 1 cut(s) 65
Bse1I ACTGG 1 cut(s) 185
BseCI ATCGAT 1 cut(s) 213
BseDI CCNNGG 1 cut(s) 138
BseGI GGATG 1 cut(s) 129
BseLI CCNNNNNNNGG 1 cut(s) 65
BseNI ACTGG 1 cut(s) 185
BshFI GGCC 1 cut(s) 170
BshVI ATCGAT 1 cut(s) 213
BsiSI CCGG 1 cut(s) 140
BslI CCNNNNNNNGG 1 cut(s) 65
BsmAI GTCTC 3 cut(s) 50, 110, 171
BsmI GAATGC 1 cut(s) 71
BsnI GGCC 1 cut(s) 170
Bso31I GGTCTC 1 cut(s) 50
Bsp143I GATC 1 cut(s) 210
BspANI GGCC 1 cut(s) 170
BspDI ATCGAT 1 cut(s) 213
BspMI ACCTGC 1 cut(s) 248
BspTNI GGTCTC 1 cut(s) 50
BsrI ACTGG 1 cut(s) 185
BssECI CCNNGG 1 cut(s) 138
BssMI GATC 1 cut(s) 210
Bst4CI ACNGT 1 cut(s) 21
BstDEI CTNAG 1 cut(s) 25
BstF5I GGATG 1 cut(s) 129
BstKTI GATC 1 cut(s) 213
BstMAI GTCTC 3 cut(s) 50, 110, 171
BstMBI GATC 1 cut(s) 210
BstSCI CCNGG 1 cut(s) 138
Bsu15I ATCGAT 1 cut(s) 213
BsuRI GGCC 1 cut(s) 170
BsuTUI ATCGAT 1 cut(s) 213
BtsCI GGATG 1 cut(s) 129
BtsI GCAGTG 1 cut(s) 94
BtsIMutI CAGTG 1 cut(s) 94
BveI ACCTGC 1 cut(s) 248
ClaI ATCGAT 1 cut(s) 213
Csp6I GTAC 1 cut(s) 32
CviAII CATG 2 cut(s) 65, 120
CviJI RGCY 1 cut(s) 170
CviKI_1 RGCY 1 cut(s) 170
CviQI GTAC 1 cut(s) 32
DdeI CTNAG 1 cut(s) 25
DpnI GATC 1 cut(s) 212
DpnII GATC 1 cut(s) 210
Eco31I GGTCTC 1 cut(s) 50
FaeI CATG 2 cut(s) 68, 123
FaiI YATR 5 cut(s) 12, 66, 77, 90, 121
FatI CATG 2 cut(s) 64, 119
FokI GGATG 1 cut(s) 136
FspBI CTAG 1 cut(s) 268
HaeIII GGCC 1 cut(s) 170
HapII CCGG 1 cut(s) 140
Hin1II CATG 2 cut(s) 68, 123
HinfI GANTC 3 cut(s) 80, 134, 260
HpaII CCGG 1 cut(s) 140
HphI GGTGA 1 cut(s) 40
Hpy188I TCNGA 3 cut(s) 107, 133, 176
Hpy188III TCNNGA 1 cut(s) 113
Hpy99I CGWCG 1 cut(s) 176
HpyCH4III ACNGT 1 cut(s) 21
HpyCH4V TGCA 4 cut(s) 4, 164, 231, 243
HpyF3I CTNAG 1 cut(s) 25
Hsp92II CATG 2 cut(s) 68, 123
Kzo9I GATC 1 cut(s) 210
LmnI GCTCC 1 cut(s) 68
LpnPI CCDG 3 cut(s) 153, 166, 253
LweI GCATC 1 cut(s) 137
MaeI CTAG 1 cut(s) 268
MaeIII GTNAC 1 cut(s) 15
MalI GATC 1 cut(s) 212
MboI GATC 1 cut(s) 210
MfeI CAATTG 1 cut(s) 159
MluCI AATT 2 cut(s) 159, 254
MlyI GAGTC 2 cut(s) 74, 128
MmeI TCCRAC 1 cut(s) 154
MspI CCGG 1 cut(s) 140
MspR9I CCNGG 1 cut(s) 140
MunI CAATTG 1 cut(s) 159
Mva1269I GAATGC 1 cut(s) 71
NciI CCSGG 1 cut(s) 140
NdeII GATC 1 cut(s) 210
NlaIII CATG 2 cut(s) 68, 123
PctI GAATGC 1 cut(s) 71
PfeI GAWTC 1 cut(s) 260
PflMI CCANNNNNTGG 1 cut(s) 65
PleI GAGTC 2 cut(s) 74, 128
PpsI GAGTC 2 cut(s) 74, 128
RsaI GTAC 1 cut(s) 33
RsaNI GTAC 1 cut(s) 32
Sau3AI GATC 1 cut(s) 210
SchI GAGTC 2 cut(s) 74, 128
ScrFI CCNGG 1 cut(s) 140
SetI ASST 2 cut(s) 17, 242
SfaNI GCATC 1 cut(s) 137
SmlI CTYRAG 1 cut(s) 111
SmoI CTYRAG 1 cut(s) 111
Sse9I AATT 2 cut(s) 159, 254
SspMI CTAG 1 cut(s) 268
StyD4I CCNGG 1 cut(s) 138
TaaI ACNGT 1 cut(s) 21
TaqI TCGA 1 cut(s) 213
TasI AATT 2 cut(s) 159, 254
TatI WGTACW 1 cut(s) 31
TfiI GAWTC 1 cut(s) 260
TscAI CASTG 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 64
TspRI CASTG 1 cut(s) 101
Van91I CCANNNNNTGG 1 cut(s) 65
XapI RAATTY 1 cut(s) 254
XspI CTAG 1 cut(s) 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.