Rh6DG166600

Hydrolyzes acetyl esters in homogalacturonan regions of pectin. In type I primary cell wall, galacturonic acid residues of pectin can be acetylated at the O-2 and O-3 positions. Decreasing the degree of acetylation of pectin gels in vitro alters their physical properties

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0000996
Physical Location & Seq
Reverse (-)
25730226 .. 25737116
6891 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG166600.1

Sequence Viewer

Length: 336 bp
ATGGCTTGTGCTCAGATCGGGTCTGGAAATACGGCGGTGTTTTGCTTCCTGATTTGCAGCAACGTCTCCGACTCTCCTCCGGCGAGTTCTTCGATCTTGTTTGTTTGGATGAGAGCCCCCCAGCTTACCATTGGTTCAGGAGTTAACAATTGGTTGGTTCACATTGAGGGAGAAGGATGGTGTAACAATGTCACAAATTGCCTCGGCCGTAAGAACACTTGTTTAGGTTCATCAAAGCAAATGCTGAAGGAAATTCCTTTTTCTGGAATTCTGAGCAACAGGCAATCACTTAATCCAGATTTGGTTGGAATTGCAACATTCTCAGAAAAGTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04310 map04310
Pfam Domains
Protein Families
PAE

Protein Analysis

111

Amino Acids

11.89

Weight (kDa)

7.58

Isoelectric Point (pI)

54.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PAE PF03283 44 - 101 2.7e-20 Pectinacetylesterase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 35
AcoI YGGCCR 1 cut(s) 205
AcsI RAATTY 2 cut(s) 252, 267
AcuI CTGAAG 1 cut(s) 266
AfiI CCNNNNNNNGG 1 cut(s) 263
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
Alw21I GWGCWC 1 cut(s) 13
Alw26I GTCTC 1 cut(s) 70
AoxI GGCC 1 cut(s) 205
ApeKI GCWGC 1 cut(s) 57
ApoI RAATTY 2 cut(s) 252, 267
BanII GRGCYC 1 cut(s) 118
Bbv12I GWGCWC 1 cut(s) 13
BbvI GCAGC 1 cut(s) 69
BccI CCATC 1 cut(s) 171
BceAI ACGGC 2 cut(s) 48, 192
BcoDI GTCTC 1 cut(s) 70
BisI GCNGC 1 cut(s) 58
BlsI GCNGC 1 cut(s) 59
BsaJI CCNNGG 1 cut(s) 202
Bsc4I CCNNNNNNNGG 1 cut(s) 263
BseDI CCNNGG 1 cut(s) 202
BseGI GGATG 2 cut(s) 114, 182
BseLI CCNNNNNNNGG 1 cut(s) 263
BseMII CTCAG 3 cut(s) 26, 263, 336
BseRI GAGGAG 1 cut(s) 66
BseX3I CGGCCG 1 cut(s) 205
BseXI GCAGC 1 cut(s) 69
BseYI CCCAGC 1 cut(s) 120
Bsh1285I CGRYCG 1 cut(s) 208
BshFI GGCC 1 cut(s) 207
BsiEI CGRYCG 1 cut(s) 208
BsiHKAI GWGCWC 1 cut(s) 13
BsiSI CCGG 1 cut(s) 80
BslI CCNNNNNNNGG 1 cut(s) 263
BsmAI GTCTC 1 cut(s) 70
BsmBI CGTCTC 1 cut(s) 70
BsnI GGCC 1 cut(s) 207
Bsp1286I GDGCHC 2 cut(s) 13, 118
Bsp143I GATC 2 cut(s) 15, 93
BspACI CCGC 1 cut(s) 35
BspANI GGCC 1 cut(s) 207
BspCNI CTCAG 3 cut(s) 25, 264, 335
BssECI CCNNGG 1 cut(s) 202
BssMI GATC 2 cut(s) 15, 93
BstDEI CTNAG 3 cut(s) 12, 272, 322
BstF5I GGATG 2 cut(s) 114, 182
BstKTI GATC 2 cut(s) 18, 96
BstMAI GTCTC 1 cut(s) 70
BstMBI GATC 2 cut(s) 15, 93
BstMCI CGRYCG 1 cut(s) 208
BstV1I GCAGC 1 cut(s) 69
BstZI CGGCCG 1 cut(s) 205
BsuRI GGCC 1 cut(s) 207
BtsCI GGATG 2 cut(s) 114, 182
CviJI RGCY 4 cut(s) 5, 116, 124, 207
CviKI_1 RGCY 4 cut(s) 5, 116, 124, 207
DdeI CTNAG 3 cut(s) 12, 272, 322
DpnI GATC 2 cut(s) 17, 95
DpnII GATC 2 cut(s) 15, 93
EaeI YGGCCR 1 cut(s) 205
EagI CGGCCG 1 cut(s) 205
EclXI CGGCCG 1 cut(s) 205
Eco24I GRGCYC 1 cut(s) 118
Eco52I CGGCCG 1 cut(s) 205
Eco57I CTGAAG 1 cut(s) 266
EcoRI GAATTC 1 cut(s) 267
EcoT38I GRGCYC 1 cut(s) 118
Esp3I CGTCTC 1 cut(s) 70
Fnu4HI GCNGC 1 cut(s) 58
FokI GGATG 2 cut(s) 121, 189
FriOI GRGCYC 1 cut(s) 118
Fsp4HI GCNGC 1 cut(s) 58
GluI GCNGC 1 cut(s) 58
GsaI CCCAGC 1 cut(s) 124
HaeIII GGCC 1 cut(s) 207
HapII CCGG 1 cut(s) 80
HincII GTYRAC 1 cut(s) 145
HindII GTYRAC 1 cut(s) 145
HinfI GANTC 1 cut(s) 71
HpaI GTTAAC 1 cut(s) 145
HpaII CCGG 1 cut(s) 80
Hpy166II GTNNAC 2 cut(s) 145, 160
Hpy188I TCNGA 4 cut(s) 15, 70, 273, 325
Hpy188III TCNNGA 5 cut(s) 24, 49, 138, 264, 296
Hpy8I GTNNAC 2 cut(s) 145, 160
HpyAV CCTTC 2 cut(s) 167, 241
HpyCH4IV ACGT 1 cut(s) 63
HpyCH4V TGCA 2 cut(s) 57, 314
HpyF3I CTNAG 3 cut(s) 12, 272, 322
HpySE526I ACGT 1 cut(s) 63
KspAI GTTAAC 1 cut(s) 145
Kzo9I GATC 2 cut(s) 15, 93
LpnPI CCDG 8 cut(s) 9, 62, 93, 123, 134, 249, 265, 309
Lsp1109I GCAGC 1 cut(s) 69
MaeII ACGT 1 cut(s) 63
MaeIII GTNAC 2 cut(s) 182, 190
MalI GATC 2 cut(s) 17, 95
MboI GATC 2 cut(s) 15, 93
MboII GAAGA 1 cut(s) 81
MfeI CAATTG 1 cut(s) 148
MhlI GDGCHC 2 cut(s) 13, 118
MluCI AATT 5 cut(s) 148, 196, 252, 267, 309
MlyI GAGTC 1 cut(s) 65
MmeI TCCRAC 2 cut(s) 93, 286
MnlI CCTC 3 cut(s) 87, 160, 212
MseI TTAA 2 cut(s) 144, 291
MspI CCGG 1 cut(s) 80
MunI CAATTG 1 cut(s) 148
NdeII GATC 2 cut(s) 15, 93
NmeAIII GCCGAG 1 cut(s) 183
NmuCI GTSAC 1 cut(s) 190
PkrI GCNGC 1 cut(s) 59
PleI GAGTC 1 cut(s) 65
PpsI GAGTC 1 cut(s) 65
PspFI CCCAGC 1 cut(s) 120
SaqAI TTAA 2 cut(s) 144, 291
SatI GCNGC 1 cut(s) 58
Sau3AI GATC 2 cut(s) 15, 93
SchI GAGTC 1 cut(s) 65
SduI GDGCHC 2 cut(s) 13, 118
SetI ASST 3 cut(s) 66, 126, 229
Sse9I AATT 5 cut(s) 148, 196, 252, 267, 309
SsiI CCGC 1 cut(s) 35
TaiI ACGT 1 cut(s) 66
TaqI TCGA 1 cut(s) 92
TasI AATT 5 cut(s) 148, 196, 252, 267, 309
Tru1I TTAA 2 cut(s) 144, 291
Tru9I TTAA 2 cut(s) 144, 291
TseFI GTSAC 1 cut(s) 190
TseI GCWGC 1 cut(s) 57
Tsp45I GTSAC 1 cut(s) 190
TspDTI ATGAA 1 cut(s) 219
XapI RAATTY 2 cut(s) 252, 267
XcmI CCANNNNNNNNNTGG 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.