Rmu_co8365615.1_g000001

Hydrolyzes acetyl esters in homogalacturonan regions of pectin. In type I primary cell wall, galacturonic acid residues of pectin can be acetylated at the O-2 and O-3 positions. Decreasing the degree of acetylation of pectin gels in vitro alters their physical properties

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8365615.1
OG0000996
Physical Location & Seq
Forward (+)
1 .. 1031
1031 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8365615.1_g000001.1.cds

Sequence Viewer

Length: 525 bp
gcttttacaattggaatagaatcaaagtcaggtactgcgatgggtcatcattcactggagatgttgaagcagtacacccaaggagctagggtttttcgagccgttattgctgatttattagcaaaaggaatggggaaagctgaaaatgctgtcctctccggttgttctgctggtggattggcctccattcttcattgtgataacttccgtgctctcttaccttccggaaccattgtgaaatgtgtttcagatgctggttactttattaatgtaaaggacatttctggagcacaacacattcaacagtattttgctgatgttgttacaacacatggttctgcgaagaatttgcctccatattgcacttcaaaattgagaccagatttgtgtttcttccctcaatatgtggtaccacagattcggacaccaatattctatgtacattcagcctatgattcatggcaggtgagcttcccagctattttcctgttaacagtaacatcgatcatactaaactgtgagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04310 map04310
Pfam Domains
Protein Families
PAE

Protein Analysis

174

Amino Acids

18.88

Weight (kDa)

8.27

Isoelectric Point (pI)

29.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 454
Acc36I ACCTGC 1 cut(s) 454
Acc65I GGTACC 1 cut(s) 409
AccB1I GGYRCC 1 cut(s) 409
AccIII TCCGGA 1 cut(s) 224
AcsI RAATTY 1 cut(s) 346
AfaI GTAC 4 cut(s) 34, 74, 411, 441
AgsI TTSAA 3 cut(s) 67, 302, 369
AluBI AGCT 4 cut(s) 86, 140, 471, 479
AluI AGCT 4 cut(s) 86, 140, 471, 479
Alw21I GWGCWC 2 cut(s) 214, 292
Alw26I GTCTC 1 cut(s) 370
AlwNI CAGNNNCTG 2 cut(s) 35, 254
Aor13HI TCCGGA 1 cut(s) 224
AoxI GGCC 1 cut(s) 180
ApoI RAATTY 1 cut(s) 346
AseI ATTAAT 1 cut(s) 267
Asp718I GGTACC 1 cut(s) 409
AsuHPI GGTGA 1 cut(s) 478
BanI GGYRCC 1 cut(s) 409
Bbv12I GWGCWC 2 cut(s) 214, 292
BccI CCATC 1 cut(s) 34
BceAI ACGGC 1 cut(s) 86
BcgI CGANNNNNNTGC 2 cut(s) 331, 365
BcoDI GTCTC 1 cut(s) 370
BfaI CTAG 1 cut(s) 87
BfuAI ACCTGC 1 cut(s) 454
BmiI GGNNCC 2 cut(s) 229, 411
BmsI GCATC 1 cut(s) 241
BpmI CTGGAG 2 cut(s) 77, 306
Bsa29I ATCGAT 1 cut(s) 503
BsaI GGTCTC 1 cut(s) 370
BsaJI CCNNGG 1 cut(s) 79
BsaWI WCCGGW 2 cut(s) 158, 224
BsaXI ACNNNNNCTCC 2 cut(s) 75, 105
Bse1I ACTGG 1 cut(s) 60
BseAI TCCGGA 1 cut(s) 224
BseCI ATCGAT 1 cut(s) 503
BseDI CCNNGG 1 cut(s) 79
BseNI ACTGG 1 cut(s) 60
BseYI CCCAGC 1 cut(s) 475
BshFI GGCC 1 cut(s) 182
BshNI GGYRCC 1 cut(s) 409
BshVI ATCGAT 1 cut(s) 503
BsiHKAI GWGCWC 2 cut(s) 214, 292
BsiSI CCGG 2 cut(s) 159, 225
BsmAI GTCTC 1 cut(s) 370
BsnI GGCC 1 cut(s) 182
Bso31I GGTCTC 1 cut(s) 370
Bsp1286I GDGCHC 2 cut(s) 214, 292
Bsp13I TCCGGA 1 cut(s) 224
Bsp1407I TGTACA 1 cut(s) 439
Bsp143I GATC 1 cut(s) 504
BspANI GGCC 1 cut(s) 182
BspDI ATCGAT 1 cut(s) 503
BspEI TCCGGA 1 cut(s) 224
BspLI GGNNCC 2 cut(s) 229, 411
BspMI ACCTGC 1 cut(s) 454
BspT107I GGYRCC 1 cut(s) 409
BspTNI GGTCTC 1 cut(s) 370
BsrGI TGTACA 1 cut(s) 439
BsrI ACTGG 1 cut(s) 60
BssECI CCNNGG 1 cut(s) 79
BssMI GATC 1 cut(s) 504
BssT1I CCWWGG 1 cut(s) 79
Bst4CI ACNGT 3 cut(s) 306, 496, 518
BstAUI TGTACA 1 cut(s) 439
BstKTI GATC 1 cut(s) 507
BstMAI GTCTC 1 cut(s) 370
BstMBI GATC 1 cut(s) 504
BstMWI GCNNNNNNNGC 2 cut(s) 107, 146
Bsu15I ATCGAT 1 cut(s) 503
BsuRI GGCC 1 cut(s) 182
BsuTUI ATCGAT 1 cut(s) 503
BtgZI GCGATG 1 cut(s) 53
BtsIMutI CAGTG 1 cut(s) 53
BveI ACCTGC 1 cut(s) 454
CaiI CAGNNNCTG 2 cut(s) 35, 254
ClaI ATCGAT 1 cut(s) 503
Csp6I GTAC 4 cut(s) 33, 73, 410, 440
CviAII CATG 2 cut(s) 332, 459
CviJI RGCY 7 cut(s) 86, 101, 140, 182, 449, 471, 479
CviKI_1 RGCY 7 cut(s) 86, 101, 140, 182, 449, 471, 479
CviQI GTAC 4 cut(s) 33, 73, 410, 440
DpnI GATC 1 cut(s) 506
DpnII GATC 1 cut(s) 504
Eco130I CCWWGG 1 cut(s) 79
Eco31I GGTCTC 1 cut(s) 370
EcoT14I CCWWGG 1 cut(s) 79
ErhI CCWWGG 1 cut(s) 79
FaeI CATG 2 cut(s) 335, 462
FaiI YATR 7 cut(s) 333, 358, 405, 438, 453, 460, 509
FatI CATG 2 cut(s) 331, 458
FspBI CTAG 1 cut(s) 87
GsaI CCCAGC 1 cut(s) 479
GsuI CTGGAG 2 cut(s) 77, 306
HaeIII GGCC 1 cut(s) 182
HapII CCGG 2 cut(s) 159, 225
Hin1II CATG 2 cut(s) 335, 462
HincII GTYRAC 1 cut(s) 492
HindII GTYRAC 1 cut(s) 492
HinfI GANTC 3 cut(s) 20, 418, 455
HpaI GTTAAC 1 cut(s) 492
HpaII CCGG 2 cut(s) 159, 225
HphI GGTGA 1 cut(s) 478
Hpy166II GTNNAC 2 cut(s) 75, 492
Hpy188I TCNGA 2 cut(s) 250, 423
Hpy188III TCNNGA 2 cut(s) 225, 285
Hpy8I GTNNAC 2 cut(s) 75, 492
HpyAV CCTTC 1 cut(s) 231
HpyCH4III ACNGT 3 cut(s) 306, 496, 518
HpyCH4V TGCA 1 cut(s) 363
HpyF10VI GCNNNNNNNGC 2 cut(s) 107, 146
Hsp92II CATG 2 cut(s) 335, 462
Kpn2I TCCGGA 1 cut(s) 224
KpnI GGTACC 1 cut(s) 413
KspAI GTTAAC 1 cut(s) 492
Kzo9I GATC 1 cut(s) 504
LmnI GCTCC 2 cut(s) 83, 287
LweI GCATC 1 cut(s) 241
MaeI CTAG 1 cut(s) 87
MaeIII GTNAC 3 cut(s) 257, 322, 496
MalI GATC 1 cut(s) 506
MboI GATC 1 cut(s) 504
MboII GAAGA 3 cut(s) 182, 355, 385
MfeI CAATTG 1 cut(s) 9
MhlI GDGCHC 2 cut(s) 214, 292
MluCI AATT 3 cut(s) 9, 346, 371
MnlI CCTC 4 cut(s) 164, 193, 363, 408
MroI TCCGGA 1 cut(s) 224
MseI TTAA 2 cut(s) 267, 491
MspI CCGG 2 cut(s) 159, 225
MunI CAATTG 1 cut(s) 9
MwoI GCNNNNNNNGC 2 cut(s) 107, 146
NdeII GATC 1 cut(s) 504
NlaIII CATG 2 cut(s) 335, 462
NlaIV GGNNCC 2 cut(s) 229, 411
PaqCI CACCTGC 1 cut(s) 454
PfeI GAWTC 3 cut(s) 20, 418, 455
PshBI ATTAAT 1 cut(s) 267
PspFI CCCAGC 1 cut(s) 475
PspN4I GGNNCC 2 cut(s) 229, 411
PstNI CAGNNNCTG 2 cut(s) 35, 254
RsaI GTAC 4 cut(s) 34, 74, 411, 441
RsaNI GTAC 4 cut(s) 33, 73, 410, 440
SaqAI TTAA 2 cut(s) 267, 491
Sau3AI GATC 1 cut(s) 504
SduI GDGCHC 2 cut(s) 214, 292
SetI ASST 7 cut(s) 34, 88, 142, 223, 468, 473, 481
SfaNI GCATC 1 cut(s) 241
Sse9I AATT 3 cut(s) 9, 346, 371
SspI AATATT 1 cut(s) 432
SspMI CTAG 1 cut(s) 87
StyI CCWWGG 1 cut(s) 79
TaaI ACNGT 3 cut(s) 306, 496, 518
TaqI TCGA 2 cut(s) 97, 503
TasI AATT 3 cut(s) 9, 346, 371
TatI WGTACW 2 cut(s) 72, 439
TfiI GAWTC 3 cut(s) 20, 418, 455
Tru1I TTAA 2 cut(s) 267, 491
Tru9I TTAA 2 cut(s) 267, 491
TscAI CASTG 1 cut(s) 60
TspDTI ATGAA 2 cut(s) 182, 447
TspGWI ACGGA 1 cut(s) 197
TspRI CASTG 1 cut(s) 60
VspI ATTAAT 1 cut(s) 267
XapI RAATTY 1 cut(s) 346
XspI CTAG 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.