Rmu_sc0001339.1_g000020

Belongs to the multi antimicrobial extrusion (MATE) (TC 2.A.66.1) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001339.1
Physical Location & Seq
Forward (+)
100119 .. 102580
2462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001339.1_g000020.1.cds

Sequence Viewer

Length: 1446 bp
atgagggaagatgaagacgaccctctggctctgttaatcccacaccatcaagaagacggtaatctgatcgaacgtacttggtcggagtcaaaaaagctatggcaagtagctgccccatccatcttcagccgcctcgctatgttctccgtcaccgtcgtcacccaatccttcgctggccacctcagtgacctcgacctcgccgccatctccatcgccaccaccgtcatcatcgccattactttcggtttcatgctaggcatggccagcgcgctcgagactctgtgtggtcaagcctacggagctaaacagtaccacatgctggggacatatctgcagcgttcttgggtagttctatttctctgcgcagtgttgcttttacccctattggtgtttgctacgccattgttgaaactcatgggactgtccgaggtcgtggccgagcagactggtttagttgccctctggttgattccatttcacttgagcttcccatttcagctgacactgcagagattcttgcagagtcagcgaaagactggagtgattgcctgggtttctggaggggttttggccctccatgtgtttgtgagttgggtttttgtgtatgagttgaggattgggattgttgggactgctcttactattggttttgcttggtggctatcggttttgggtttgtttgtgtacactgtttgtggtgggtgtttggaaacatggactggtttttcagctcaagcttttgttgggctctgggatttctttaagctttctttggcttctgggttcatgctcttagtggagaatttttattttagagttttggtgatagtgtctggatatatgcacaataccgagattgctgttgatgccctttccatctgcatgagtatctatgcttgggagtccatgattccactaggatttttggcagcagttggagtgcgggtagcaaatgaacttggcgcaagcaacgcaaaaggtgcaaaatttgcaaccacagtttcagtcttgacctccctagcagtgggacttctattttgtttaataattatagtcttccatgagaagcttgcaatgatctttacctccagcattcctgttattgctatggtcaatgatttatcagtcttgttggcattcactattctcctcagttgcattcaaccagtgctctcaggggtagcaatcggatctggtcggcaagcaatagtagctattgtaaatataggtagctactacctggttggcatgcctgttggggttgttttaggatggttgctagtgtttggtatcaagggtatgtgggctggaatgatctgtggaattgtggttcaaaccttgatactgataattatcaccatgagatgtgattgggaaaaagaggcagagagagctcgaattcacataacaaaggatgcagcttcaccattgatctttgctcaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

481

Amino Acids

52.49

Weight (kDa)

6.14

Isoelectric Point (pI)

31.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000476)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G10420 AT5G44050 AT5G65380
fragaria_vesca FvH4_1g20090 FvH4_1g20090 FvH4_1g20090 FvH4_1g20090 FvH4_1g20090 FvH4_1g20090 FvH4_1g20090 FvH4_5g36160 FvH4_5g36160 FvH4_5g36160 FvH4_5g36160 FvH4_5g36160 FvH4_5g36160 FvH4_5g36170 FvH4_5g36191 FvH4_5g36191 FvH4_5g36191 FvH4_5g36191 FvH4_5g36191 FvH4_7g30730 FvH4_7g30730
malus_domestica MD01G1032800.v1.1 MD08G1190900.v1.1 MD08G1191000.v1.1 MD15G1378200.v1.1 MD15G1378900.v1.1 MD15G1379100.v1.1
prunus_persica Prupe.1G524800_v2.0.a1 Prupe.1G525000_v2.0.a1 Prupe.1G525200_v2.0.a1 Prupe.1G525300_v2.0.a1 Prupe.1G525300_v2.0.a1 Prupe.1G525300_v2.0.a1 Prupe.6G195500_v2.0.a1
pyrus_communis pycom01g06450 pycom08g16390 pycom15g33900 pycom15g33930 pycom15g33950
rosa_chinensis RchiOBHm_Chr2g0112071 RchiOBHm_Chr7g0237941 RchiOBHm_Chr7g0237951 RchiOBHm_Chr7g0237971 RchiOBHm_Chr7g0238021
rosa_laevigata RLG00000000946 RLG00000000947 RLG00000000949 RLG00000017947
rosa_multiflora Rmu_co8087868.1_g000001 Rmu_co8407183.1_g000001 Rmu_co8459217.1_g000001 Rmu_sc0001339.1_g000020 Rmu_sc0002041.1_g000021 Rmu_sc0002586.1_g000009 Rmu_sc0002877.1_g000026 Rmu_sc0002877.1_g000032
rosa_roxburghii Rroxscaffold_2G00131800 Rroxscaffold_3G00223450 Rroxscaffold_3G00223470 Rroxscaffold_3G00223480
rosa_rugosa Rorug02G0178300 Rorug07G0309600 Rorug07G0309700.1 Rorug07G0309800.1 Rorug07G0309900.1 Rorug07G0310000 Rorug07G0310100
rosa_samantha Rh2AG230300 Rh2BG243500 Rh2DG238200 Rh7AG464600 Rh7AG464700 Rh7AG464900 Rh7BG435300 Rh7BG435600 Rh7CG482800 Rh7CG483100 Rh7CG483500 Rh7DG451500 Rh7DG451700 Rh7DG451800
rosa_wichuraiana Rw2G017840 Rw2G017890 Rw7G038490 Rw7G038500 Rw7G038510 Rw7G038540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 364
AccB7I CCANNNNNTGG 1 cut(s) 319
AccII CGCG 1 cut(s) 269
AciI CCGC 3 cut(s) 130, 201, 943
AclWI GGATC 1 cut(s) 1198
AcoI YGGCCR 3 cut(s) 175, 261, 435
AcsI RAATTY 3 cut(s) 802, 986, 1398
AcuI CTGAAG 1 cut(s) 109
AfaI GTAC 3 cut(s) 76, 311, 686
AfiI CCNNNNNNNGG 2 cut(s) 319, 1024
AgsI TTSAA 3 cut(s) 409, 1163, 1334
AjnI CCWGG 2 cut(s) 548, 1239
AleI CACNNNNGTG 1 cut(s) 183
AloI GAACNNNNNNTCC 2 cut(s) 1314, 1346
Alw21I GWGCWC 2 cut(s) 1173, 1396
Alw26I GTCTC 1 cut(s) 269
AlwI GGATC 1 cut(s) 1198
Ama87I CYCGRG 1 cut(s) 272
AoxI GGCC 4 cut(s) 175, 261, 435, 570
ApeKI GCWGC 4 cut(s) 110, 334, 929, 1418
ApoI RAATTY 3 cut(s) 802, 986, 1398
ArsI GACNNNNNNTTYG 2 cut(s) 1020, 1052
AspLEI GCGC 4 cut(s) 269, 271, 365, 965
AspS9I GGNCC 1 cut(s) 571
AsuHPI GGTGA 5 cut(s) 142, 151, 835, 1348, 1416
AvaI CYCGRG 1 cut(s) 272
BalI TGGCCA 2 cut(s) 177, 263
BanII GRGCYC 2 cut(s) 750, 1396
BbsI GAAGAC 3 cut(s) 21, 60, 1048
Bbv12I GWGCWC 2 cut(s) 1173, 1396
BbvI GCAGC 4 cut(s) 97, 346, 941, 1430
BccI CCATC 7 cut(s) 54, 124, 128, 212, 218, 884, 1266
BciT130I CCWGG 2 cut(s) 550, 1241
BcoDI GTCTC 1 cut(s) 269
BfaI CTAG 4 cut(s) 254, 917, 1019, 1280
BfmI CTRYAG 2 cut(s) 332, 506
BisI GCNGC 6 cut(s) 111, 130, 201, 335, 930, 1419
BlsI GCNGC 6 cut(s) 112, 131, 202, 336, 931, 1420
Bme1390I CCNGG 2 cut(s) 550, 1241
BmeT110I CYCGRG 1 cut(s) 272
BmgT120I GGNCC 1 cut(s) 571
BmrFI CCNGG 2 cut(s) 550, 1241
BmsI GCATC 2 cut(s) 856, 1405
BpiI GAAGAC 3 cut(s) 21, 60, 1048
BpmI CTGGAG 3 cut(s) 558, 579, 1072
BpuEI CTTGAG 2 cut(s) 502, 717
BsaBI GATNNNNATC 1 cut(s) 1352
BsaJI CCNNGG 2 cut(s) 426, 549
BsaXI ACNNNNNCTCC 2 cut(s) 930, 960
Bsc4I CCNNNNNNNGG 2 cut(s) 319, 1024
Bse1I ACTGG 4 cut(s) 451, 541, 724, 1166
Bse3DI GCAATG 1 cut(s) 1080
Bse8I GATNNNNATC 1 cut(s) 1352
BseBI CCWGG 2 cut(s) 550, 1241
BseDI CCNNGG 2 cut(s) 426, 549
BseGI GGATG 3 cut(s) 116, 1277, 1420
BseJI GATNNNNATC 1 cut(s) 1352
BseLI CCNNNNNNNGG 2 cut(s) 319, 1024
BseMI GCAATG 1 cut(s) 1080
BseMII CTCAG 3 cut(s) 196, 1165, 1188
BseNI ACTGG 4 cut(s) 451, 541, 724, 1166
BsePI GCGCGC 1 cut(s) 267
BseRI GAGGAG 1 cut(s) 1139
BseXI GCAGC 4 cut(s) 97, 346, 941, 1430
BseYI CCCAGC 1 cut(s) 319
Bsh1236I CGCG 1 cut(s) 269
BshFI GGCC 4 cut(s) 177, 263, 437, 572
BsiHKAI GWGCWC 2 cut(s) 1173, 1396
BsiHKCI CYCGRG 1 cut(s) 272
BslFI GGGAC 4 cut(s) 337, 432, 643, 1041
BslI CCNNNNNNNGG 2 cut(s) 319, 1024
BsmAI GTCTC 1 cut(s) 269
BsmFI GGGAC 4 cut(s) 337, 432, 643, 1041
BsmI GAATGC 3 cut(s) 1092, 1136, 1158
BsnI GGCC 4 cut(s) 177, 263, 437, 572
BsoBI CYCGRG 1 cut(s) 272
Bsp1286I GDGCHC 3 cut(s) 750, 1173, 1396
Bsp1407I TGTACA 1 cut(s) 684
Bsp143I GATC 5 cut(s) 66, 1077, 1190, 1314, 1431
BspACI CCGC 3 cut(s) 130, 201, 943
BspANI GGCC 4 cut(s) 177, 263, 437, 572
BspCNI CTCAG 3 cut(s) 195, 1164, 1187
BspFNI CGCG 1 cut(s) 269
BspMAI CTGCAG 2 cut(s) 336, 510
BspPI GGATC 1 cut(s) 1198
BsrDI GCAATG 1 cut(s) 1080
BsrGI TGTACA 1 cut(s) 684
BsrI ACTGG 4 cut(s) 451, 541, 724, 1166
BssECI CCNNGG 2 cut(s) 426, 549
BssHII GCGCGC 1 cut(s) 267
BssMI GATC 5 cut(s) 66, 1077, 1190, 1314, 1431
Bst2UI CCWGG 2 cut(s) 550, 1241
Bst4CI ACNGT 7 cut(s) 59, 154, 223, 309, 423, 691, 1000
BstAPI GCANNNNNTGC 2 cut(s) 980, 989
BstAUI TGTACA 1 cut(s) 684
BstC8I GCNNGC 7 cut(s) 175, 265, 269, 967, 1071, 1203, 1250
BstDEI CTNAG 4 cut(s) 182, 793, 1151, 1174
BstF5I GGATG 3 cut(s) 116, 1277, 1420
BstFNI CGCG 1 cut(s) 269
BstHHI GCGC 4 cut(s) 269, 271, 365, 965
BstKTI GATC 5 cut(s) 69, 1080, 1193, 1317, 1434
BstMAI GTCTC 1 cut(s) 269
BstMBI GATC 5 cut(s) 66, 1077, 1190, 1314, 1431
BstNI CCWGG 2 cut(s) 550, 1241
BstNSI RCATGY 2 cut(s) 319, 1252
BstSCI CCNGG 2 cut(s) 548, 1239
BstSFI CTRYAG 2 cut(s) 332, 506
BstUI CGCG 1 cut(s) 269
BstV1I GCAGC 4 cut(s) 97, 346, 941, 1430
BstV2I GAAGAC 3 cut(s) 21, 60, 1048
BstX2I RGATCY 1 cut(s) 1190
BstYI RGATCY 1 cut(s) 1190
BsuRI GGCC 4 cut(s) 177, 263, 437, 572
BtgZI GCGATG 2 cut(s) 196, 214
BtsCI GGATG 3 cut(s) 116, 1277, 1420
BtsI GCAGTG 3 cut(s) 372, 503, 1029
BtsIMutI CAGTG 6 cut(s) 190, 372, 503, 687, 1029, 1173
Cac8I GCNNGC 7 cut(s) 175, 265, 269, 967, 1071, 1203, 1250
CfoI GCGC 4 cut(s) 269, 271, 365, 965
Cfr13I GGNCC 1 cut(s) 571
CsiI ACCWGGT 1 cut(s) 1239
Csp6I GTAC 3 cut(s) 75, 310, 685
CviQI GTAC 3 cut(s) 75, 310, 685
DdeI CTNAG 4 cut(s) 182, 793, 1151, 1174
DpnI GATC 5 cut(s) 68, 1079, 1192, 1316, 1433
DpnII GATC 5 cut(s) 66, 1077, 1190, 1314, 1431
EaeI YGGCCR 3 cut(s) 175, 261, 435
Ecl136II GAGCTC 1 cut(s) 1394
Eco24I GRGCYC 2 cut(s) 750, 1396
Eco53kI GAGCTC 1 cut(s) 1394
Eco57I CTGAAG 1 cut(s) 109
Eco88I CYCGRG 1 cut(s) 272
EcoICRI GAGCTC 1 cut(s) 1394
EcoRI GAATTC 1 cut(s) 1398
EcoRII CCWGG 2 cut(s) 548, 1239
EcoT38I GRGCYC 2 cut(s) 750, 1396
FaqI GGGAC 4 cut(s) 337, 432, 643, 1041
FauI CCCGC 1 cut(s) 936
Fnu4HI GCNGC 6 cut(s) 111, 130, 201, 335, 930, 1419
FokI GGATG 3 cut(s) 103, 1284, 1427
FriOI GRGCYC 2 cut(s) 750, 1396
Fsp4HI GCNGC 6 cut(s) 111, 130, 201, 335, 930, 1419
FspBI CTAG 4 cut(s) 254, 917, 1019, 1280
FspI TGCGCA 1 cut(s) 364
GlaI GCGC 4 cut(s) 268, 270, 364, 964
GluI GCNGC 6 cut(s) 111, 130, 201, 335, 930, 1419
GsaI CCCAGC 1 cut(s) 323
GsuI CTGGAG 3 cut(s) 558, 579, 1072
HaeIII GGCC 4 cut(s) 177, 263, 437, 572
HhaI GCGC 4 cut(s) 269, 271, 365, 965
Hin6I GCGC 4 cut(s) 267, 269, 363, 963
HinP1I GCGC 4 cut(s) 267, 269, 363, 963
HindIII AAGCTT 3 cut(s) 735, 764, 1067
HinfI GANTC 7 cut(s) 86, 277, 469, 513, 523, 902, 910
HphI GGTGA 5 cut(s) 142, 151, 835, 1348, 1416
Hpy166II GTNNAC 2 cut(s) 685, 687
Hpy188I TCNGA 4 cut(s) 66, 85, 427, 1190
Hpy188III TCNNGA 5 cut(s) 50, 274, 558, 834, 1009
Hpy8I GTNNAC 2 cut(s) 685, 687
Hpy99I CGWCG 1 cut(s) 158
HpyAV CCTTC 1 cut(s) 178
HpyCH4III ACNGT 7 cut(s) 59, 154, 223, 309, 423, 691, 1000
HpyCH4IV ACGT 1 cut(s) 73
HpyF3I CTNAG 4 cut(s) 182, 793, 1151, 1174
HpySE526I ACGT 1 cut(s) 73
HspAI GCGC 4 cut(s) 267, 269, 363, 963
Kzo9I GATC 5 cut(s) 66, 1077, 1190, 1314, 1431
LmnI GCTCC 1 cut(s) 299
Lsp1109I GCAGC 4 cut(s) 97, 346, 941, 1430
LweI GCATC 2 cut(s) 856, 1405
MabI ACCWGGT 1 cut(s) 1239
MaeI CTAG 4 cut(s) 254, 917, 1019, 1280
MaeII ACGT 1 cut(s) 73
MaeIII GTNAC 3 cut(s) 148, 157, 185
MalI GATC 5 cut(s) 68, 1079, 1192, 1316, 1433
MboI GATC 5 cut(s) 66, 1077, 1190, 1314, 1431
MboII GAAGA 5 cut(s) 20, 26, 65, 115, 1048
MflI RGATCY 1 cut(s) 1190
MhlI GDGCHC 3 cut(s) 750, 1173, 1396
MlsI TGGCCA 2 cut(s) 177, 263
MluCI AATT 6 cut(s) 802, 986, 1047, 1323, 1350, 1398
MluNI TGGCCA 2 cut(s) 177, 263
MlyI GAGTC 4 cut(s) 95, 271, 532, 911
MmeI TCCRAC 2 cut(s) 63, 916
Mox20I TGGCCA 2 cut(s) 177, 263
MscI TGGCCA 2 cut(s) 177, 263
MseI TTAA 3 cut(s) 35, 762, 1043
MslI CAYNNNNRTG 2 cut(s) 183, 881
Msp20I TGGCCA 2 cut(s) 177, 263
MspA1I CMGCKG 1 cut(s) 499
MspR9I CCNGG 2 cut(s) 550, 1241
Mva1269I GAATGC 3 cut(s) 1092, 1136, 1158
MvaI CCWGG 2 cut(s) 550, 1241
MvnI CGCG 1 cut(s) 269
NdeII GATC 5 cut(s) 66, 1077, 1190, 1314, 1431
NmeAIII GCCGAG 1 cut(s) 463
NmuCI GTSAC 3 cut(s) 148, 157, 185
NsbI TGCGCA 1 cut(s) 364
NspI RCATGY 2 cut(s) 319, 1252
OliI CACNNNNGTG 1 cut(s) 183
PaeI GCATGC 1 cut(s) 1252
PaeR7I CTCGAG 1 cut(s) 272
PauI GCGCGC 1 cut(s) 267
PcsI WCGNNNNNNNCGW 1 cut(s) 219
PctI GAATGC 3 cut(s) 1092, 1136, 1158
PfeI GAWTC 3 cut(s) 469, 513, 910
PflMI CCANNNNNTGG 1 cut(s) 319
PkrI GCNGC 6 cut(s) 112, 131, 202, 336, 931, 1420
PleI GAGTC 4 cut(s) 94, 271, 531, 910
PpsI GAGTC 4 cut(s) 94, 271, 531, 910
Psp124BI GAGCTC 1 cut(s) 1396
Psp6I CCWGG 2 cut(s) 548, 1239
PspFI CCCAGC 1 cut(s) 319
PspGI CCWGG 2 cut(s) 548, 1239
PspPI GGNCC 1 cut(s) 571
PstI CTGCAG 2 cut(s) 336, 510
PsuI RGATCY 1 cut(s) 1190
PteI GCGCGC 1 cut(s) 267
PvuII CAGCTG 1 cut(s) 499
RsaI GTAC 3 cut(s) 76, 311, 686
RsaNI GTAC 3 cut(s) 75, 310, 685
RseI CAYNNNNRTG 2 cut(s) 183, 881
SacI GAGCTC 1 cut(s) 1396
SaqAI TTAA 3 cut(s) 35, 762, 1043
SatI GCNGC 6 cut(s) 111, 130, 201, 335, 930, 1419
Sau3AI GATC 5 cut(s) 66, 1077, 1190, 1314, 1431
Sau96I GGNCC 1 cut(s) 571
SchI GAGTC 4 cut(s) 95, 271, 532, 911
ScrFI CCNGG 2 cut(s) 550, 1241
SduI GDGCHC 3 cut(s) 750, 1173, 1396
SexAI ACCWGGT 1 cut(s) 1239
SfaNI GCATC 2 cut(s) 856, 1405
SfcI CTRYAG 2 cut(s) 332, 506
Sfr274I CTCGAG 1 cut(s) 272
SlaI CTCGAG 1 cut(s) 272
SmiMI CAYNNNNRTG 2 cut(s) 183, 881
SmlI CTYRAG 3 cut(s) 272, 481, 732
SmoI CTYRAG 3 cut(s) 272, 481, 732
SphI GCATGC 1 cut(s) 1252
Sse9I AATT 6 cut(s) 802, 986, 1047, 1323, 1350, 1398
SsiI CCGC 3 cut(s) 130, 201, 943
SspMI CTAG 4 cut(s) 254, 917, 1019, 1280
SstI GAGCTC 1 cut(s) 1396
StyD4I CCNGG 2 cut(s) 548, 1239
TaaI ACNGT 7 cut(s) 59, 154, 223, 309, 423, 691, 1000
TaiI ACGT 1 cut(s) 76
TaqI TCGA 4 cut(s) 69, 192, 273, 1396
TasI AATT 6 cut(s) 802, 986, 1047, 1323, 1350, 1398
TatI WGTACW 1 cut(s) 684
TauI GCSGC 2 cut(s) 132, 203
TfiI GAWTC 3 cut(s) 469, 513, 910
Tru1I TTAA 3 cut(s) 35, 762, 1043
Tru9I TTAA 3 cut(s) 35, 762, 1043
TscAI CASTG 6 cut(s) 190, 372, 510, 694, 1029, 1173
TseFI GTSAC 3 cut(s) 148, 157, 185
TseI GCWGC 4 cut(s) 110, 334, 929, 1418
Tsp45I GTSAC 3 cut(s) 148, 157, 185
TspDTI ATGAA 4 cut(s) 27, 238, 775, 969
TspGWI ACGGA 2 cut(s) 136, 312
TspRI CASTG 6 cut(s) 190, 372, 510, 694, 1029, 1173
Van91I CCANNNNNTGG 1 cut(s) 319
XapI RAATTY 3 cut(s) 802, 986, 1398
XceI RCATGY 2 cut(s) 319, 1252
XcmI CCANNNNNNNNNTGG 1 cut(s) 170
XhoI CTCGAG 1 cut(s) 272
XspI CTAG 4 cut(s) 254, 917, 1019, 1280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.